Incidental Mutation 'R5639:Bicc1'
ID440558
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 043288-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5639 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70940520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 701 (V701E)
Ref Sequence ENSEMBL: ENSMUSP00000119137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably damaging
Transcript: ENSMUST00000014473
AA Change: V783E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: V783E

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131445
AA Change: V701E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: V701E

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: V783E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: V783E

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,043,234 Y322H probably benign Het
Aldh1a1 C A 19: 20,623,422 T201K probably damaging Het
Ankrd26 T C 6: 118,539,724 E493G possibly damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Car11 T A 7: 45,702,621 probably null Het
Celsr1 C G 15: 86,030,767 V1002L probably damaging Het
Clpx T A 9: 65,329,830 S597T probably benign Het
Cyr61 A C 3: 145,648,697 V153G probably damaging Het
Dmpk A G 7: 19,092,600 M545V probably benign Het
Dnah7c C G 1: 46,739,668 D3139E probably benign Het
Drd5 T A 5: 38,319,835 V57D possibly damaging Het
Epc2 A G 2: 49,451,891 N29S possibly damaging Het
Ercc3 T C 18: 32,265,714 V682A probably damaging Het
Fam186a T C 15: 99,947,050 K438E unknown Het
Farp1 T A 14: 121,275,382 I764N probably damaging Het
Flvcr2 A T 12: 85,747,476 I209F probably benign Het
Fndc3b C T 3: 27,426,153 V1065M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gp6 C A 7: 4,394,131 D102Y probably damaging Het
Gpc5 T C 14: 115,092,747 L114P probably benign Het
Kcnq3 T A 15: 65,997,750 E613V probably damaging Het
Krt74 T G 15: 101,756,760 noncoding transcript Het
Lipe T C 7: 25,383,325 T801A probably benign Het
Lman1l A T 9: 57,611,866 F266I probably benign Het
Lrp1 A G 10: 127,593,839 V454A probably damaging Het
Lsm14a T C 7: 34,353,510 D338G probably damaging Het
Mctp1 T C 13: 77,024,783 silent Het
Mgea5 A G 19: 45,776,999 I123T probably damaging Het
Nlrp4a G A 7: 26,457,030 A727T probably benign Het
Nrgn T C 9: 37,546,048 S48G probably benign Het
Olfr1246 T C 2: 89,590,725 Y130C probably damaging Het
Olfr370 T C 8: 83,541,344 S67P probably damaging Het
Olfr564 A G 7: 102,803,993 S172G probably benign Het
Pdia6 A G 12: 17,278,593 E183G probably benign Het
Pign T A 1: 105,589,315 I529F probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Samm50 T G 15: 84,214,128 I456S probably benign Het
Sesn1 A G 10: 41,811,271 R84G probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Spag17 G T 3: 100,056,166 D1067Y probably damaging Het
Sptan1 C T 2: 29,990,993 Q425* probably null Het
Srrm4 T A 5: 116,591,359 I36F unknown Het
Tas1r2 A T 4: 139,659,796 S189C probably damaging Het
Tep1 A G 14: 50,853,605 V690A possibly damaging Het
Trmo T C 4: 46,382,073 K348R probably benign Het
Trmu T A 15: 85,882,698 M36K probably damaging Het
Ubr4 A G 4: 139,452,648 T3380A possibly damaging Het
Unc79 A C 12: 103,171,572 T2425P probably damaging Het
Vmn2r12 G A 5: 109,092,800 T149I probably benign Het
Vwa3a A C 7: 120,790,143 K68T probably damaging Het
Yif1a T C 19: 5,088,750 probably null Het
Zbtb44 A T 9: 31,054,052 T253S probably damaging Het
Zdhhc3 T C 9: 123,100,345 Y75C probably damaging Het
Zfp189 T A 4: 49,530,153 F419I probably benign Het
Zfp663 T C 2: 165,353,009 D430G probably benign Het
Zfp709 T G 8: 71,889,991 probably null Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTGCAGCTGCTCTTTG -3'
(R):5'- GAATGAAGAAACCTTGTTCCCC -3'

Sequencing Primer
(F):5'- ACCCCACTTTATCATGTAGGATAC -3'
(R):5'- TGAAGAAACCTTGTTCCCCCTCAG -3'
Posted On2016-11-08