Incidental Mutation 'R5639:Krt74'
ID440570
Institutional Source Beutler Lab
Gene Symbol Krt74
Ensembl Gene ENSMUSG00000067596
Gene Namekeratin 74
SynonymsKb37
MMRRC Submission 043288-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5639 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101754259-101763504 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to G at 101756760 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000088018]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088018
SMART Domains Protein: ENSMUSP00000085335
Gene: ENSMUSG00000067596

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 102 9e-21 PFAM
Filament 105 418 6.41e-143 SMART
low complexity region 425 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229279
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,043,234 Y322H probably benign Het
Aldh1a1 C A 19: 20,623,422 T201K probably damaging Het
Ankrd26 T C 6: 118,539,724 E493G possibly damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Bicc1 A T 10: 70,940,520 V701E probably damaging Het
Car11 T A 7: 45,702,621 probably null Het
Celsr1 C G 15: 86,030,767 V1002L probably damaging Het
Clpx T A 9: 65,329,830 S597T probably benign Het
Cyr61 A C 3: 145,648,697 V153G probably damaging Het
Dmpk A G 7: 19,092,600 M545V probably benign Het
Dnah7c C G 1: 46,739,668 D3139E probably benign Het
Drd5 T A 5: 38,319,835 V57D possibly damaging Het
Epc2 A G 2: 49,451,891 N29S possibly damaging Het
Ercc3 T C 18: 32,265,714 V682A probably damaging Het
Fam186a T C 15: 99,947,050 K438E unknown Het
Farp1 T A 14: 121,275,382 I764N probably damaging Het
Flvcr2 A T 12: 85,747,476 I209F probably benign Het
Fndc3b C T 3: 27,426,153 V1065M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gp6 C A 7: 4,394,131 D102Y probably damaging Het
Gpc5 T C 14: 115,092,747 L114P probably benign Het
Kcnq3 T A 15: 65,997,750 E613V probably damaging Het
Lipe T C 7: 25,383,325 T801A probably benign Het
Lman1l A T 9: 57,611,866 F266I probably benign Het
Lrp1 A G 10: 127,593,839 V454A probably damaging Het
Lsm14a T C 7: 34,353,510 D338G probably damaging Het
Mctp1 T C 13: 77,024,783 silent Het
Mgea5 A G 19: 45,776,999 I123T probably damaging Het
Nlrp4a G A 7: 26,457,030 A727T probably benign Het
Nrgn T C 9: 37,546,048 S48G probably benign Het
Olfr1246 T C 2: 89,590,725 Y130C probably damaging Het
Olfr370 T C 8: 83,541,344 S67P probably damaging Het
Olfr564 A G 7: 102,803,993 S172G probably benign Het
Pdia6 A G 12: 17,278,593 E183G probably benign Het
Pign T A 1: 105,589,315 I529F probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Samm50 T G 15: 84,214,128 I456S probably benign Het
Sesn1 A G 10: 41,811,271 R84G probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Spag17 G T 3: 100,056,166 D1067Y probably damaging Het
Sptan1 C T 2: 29,990,993 Q425* probably null Het
Srrm4 T A 5: 116,591,359 I36F unknown Het
Tas1r2 A T 4: 139,659,796 S189C probably damaging Het
Tep1 A G 14: 50,853,605 V690A possibly damaging Het
Trmo T C 4: 46,382,073 K348R probably benign Het
Trmu T A 15: 85,882,698 M36K probably damaging Het
Ubr4 A G 4: 139,452,648 T3380A possibly damaging Het
Unc79 A C 12: 103,171,572 T2425P probably damaging Het
Vmn2r12 G A 5: 109,092,800 T149I probably benign Het
Vwa3a A C 7: 120,790,143 K68T probably damaging Het
Yif1a T C 19: 5,088,750 probably null Het
Zbtb44 A T 9: 31,054,052 T253S probably damaging Het
Zdhhc3 T C 9: 123,100,345 Y75C probably damaging Het
Zfp189 T A 4: 49,530,153 F419I probably benign Het
Zfp663 T C 2: 165,353,009 D430G probably benign Het
Zfp709 T G 8: 71,889,991 probably null Het
Other mutations in Krt74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Krt74 APN 15 101756794 exon noncoding transcript
IGL02376:Krt74 APN 15 101754503 exon noncoding transcript
IGL02507:Krt74 APN 15 101760624 exon noncoding transcript
IGL03374:Krt74 APN 15 101760502 splice site noncoding transcript
R0032:Krt74 UTSW 15 101761452 exon noncoding transcript
R0032:Krt74 UTSW 15 101761452 exon noncoding transcript
R0110:Krt74 UTSW 15 101763316 exon noncoding transcript
R0450:Krt74 UTSW 15 101763316 exon noncoding transcript
R0469:Krt74 UTSW 15 101763316 exon noncoding transcript
R0510:Krt74 UTSW 15 101763316 exon noncoding transcript
R0550:Krt74 UTSW 15 101760679 splice site noncoding transcript
R0558:Krt74 UTSW 15 101760963 exon noncoding transcript
R1663:Krt74 UTSW 15 101756674 exon noncoding transcript
R2392:Krt74 UTSW 15 101756801 splice site noncoding transcript
R3772:Krt74 UTSW 15 101762195 exon noncoding transcript
R4167:Krt74 UTSW 15 101758869 exon noncoding transcript
R4670:Krt74 UTSW 15 101758869 exon noncoding transcript
R4741:Krt74 UTSW 15 101761441 exon noncoding transcript
R5470:Krt74 UTSW 15 101754465 exon noncoding transcript
R5664:Krt74 UTSW 15 101760579 exon noncoding transcript
R6274:Krt74 UTSW 15 101763437 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GAGAAACTACAGCTGTTCCTCC -3'
(R):5'- GGCTACTCTGTTACTCTACCACAG -3'

Sequencing Primer
(F):5'- ACAGTGGTGTTGCCCTCCAG -3'
(R):5'- AGTCTATCATGACAGGCTGC -3'
Posted On2016-11-08