Incidental Mutation 'R5640:Ipp'
ID440588
Institutional Source Beutler Lab
Gene Symbol Ipp
Ensembl Gene ENSMUSG00000028696
Gene NameIAP promoted placental gene
SynonymsD4Jhu8, Mipp
MMRRC Submission 043289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5640 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116507549-116538243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 116520689 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 252 (L252R)
Ref Sequence ENSEMBL: ENSMUSP00000102088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030461] [ENSMUST00000106479]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030461
AA Change: L252R

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030461
Gene: ENSMUSG00000028696
AA Change: L252R

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106479
AA Change: L252R

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102088
Gene: ENSMUSG00000028696
AA Change: L252R

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 50 amino acid repeat which interacts with actin. Transcript variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,970,685 Y220C probably damaging Het
Actl6a A G 3: 32,718,050 T170A probably damaging Het
Adamts8 T C 9: 30,956,500 V540A probably benign Het
Aga T C 8: 53,511,884 L27P probably damaging Het
Agmat T A 4: 141,755,823 H189Q probably damaging Het
Alx3 C A 3: 107,600,661 T162K probably damaging Het
Armc2 T A 10: 42,011,898 I30L possibly damaging Het
Arntl C T 7: 113,308,681 P530L probably damaging Het
Atp10d T G 5: 72,247,209 Y487D probably damaging Het
Atp13a4 C T 16: 29,415,831 M908I probably damaging Het
B4galt2 T G 4: 117,873,998 N322T probably benign Het
Brdt A T 5: 107,359,308 K525* probably null Het
Ces3a T A 8: 105,051,745 M246K probably benign Het
Chd9 T A 8: 91,036,562 H2338Q probably damaging Het
Cyp3a16 T A 5: 145,452,823 D244V possibly damaging Het
Dhrs9 C A 2: 69,394,478 A170E probably damaging Het
Dlg5 T C 14: 24,170,461 N550D probably damaging Het
Dnah8 C T 17: 30,803,108 T3894I probably damaging Het
Dpys T C 15: 39,842,066 H217R probably damaging Het
Dpysl2 C T 14: 66,834,368 V108I probably benign Het
Eprs A G 1: 185,374,184 T199A probably benign Het
Fads1 A G 19: 10,186,403 D183G probably damaging Het
Fam110b T G 4: 5,798,689 Y36D probably damaging Het
Fbxl21 G A 13: 56,537,381 D407N probably benign Het
Fuca2 G A 10: 13,507,430 probably null Het
Gm8251 T C 1: 44,061,927 I4V probably benign Het
Gnas C A 2: 174,284,971 R100S probably benign Het
Gse1 A G 8: 120,562,677 H90R possibly damaging Het
Hoxc10 G T 15: 102,967,267 C137F probably benign Het
Jmjd1c T A 10: 67,226,078 S1403R probably benign Het
Kif19a A G 11: 114,779,215 M79V probably benign Het
Lipo4 T C 19: 33,501,586 T285A possibly damaging Het
Lrrc66 A T 5: 73,608,634 D355E probably benign Het
Lrsam1 T A 2: 32,945,852 Q301L probably benign Het
Med6 C T 12: 81,581,854 R138Q probably damaging Het
Nlrc5 A G 8: 94,475,793 T174A probably benign Het
Nrbp1 C T 5: 31,249,585 R322W possibly damaging Het
Olfr1256 T A 2: 89,835,938 E2D probably benign Het
Olfr1338 T A 4: 118,753,789 T250S probably benign Het
Olfr739 C A 14: 50,424,654 A45D probably benign Het
Pde3a A G 6: 141,483,915 E734G probably damaging Het
Pnpla7 C T 2: 25,003,001 T167I possibly damaging Het
Pop7 T C 5: 137,502,059 N4S possibly damaging Het
Ppm1h C A 10: 122,782,278 P114Q probably benign Het
Prdm16 T C 4: 154,341,910 T473A probably benign Het
Prdm6 T C 18: 53,536,741 probably null Het
Prkdc T G 16: 15,829,769 W3686G possibly damaging Het
Ptchd4 C A 17: 42,503,135 H642Q possibly damaging Het
Rad1 A G 15: 10,495,923 Y228C possibly damaging Het
Rgs22 G A 15: 36,106,955 T56I probably benign Het
Rnf135 C A 11: 80,193,907 H169N probably benign Het
Rnft1 C T 11: 86,486,493 Q128* probably null Het
Sez6 T C 11: 77,973,759 probably benign Het
Sh3rf3 A G 10: 58,813,947 S125G probably benign Het
Sik2 T C 9: 50,915,506 E295G possibly damaging Het
Themis A G 10: 28,863,376 Q614R probably damaging Het
Thsd7b T A 1: 130,116,671 C1129* probably null Het
Tmem68 A T 4: 3,569,512 F59L probably benign Het
Tmem8 C T 17: 26,118,872 T410I possibly damaging Het
Vmn2r107 A G 17: 20,375,164 T660A probably damaging Het
Vwa5b2 G T 16: 20,597,542 C484F probably damaging Het
Zfp418 T A 7: 7,181,981 C314* probably null Het
Other mutations in Ipp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ipp APN 4 116532659 missense possibly damaging 0.93
IGL01399:Ipp APN 4 116515187 missense probably damaging 1.00
IGL01934:Ipp APN 4 116510655 missense probably damaging 0.99
IGL02805:Ipp APN 4 116529688 missense possibly damaging 0.92
Iguacu UTSW 4 116537938 nonsense probably null
R0582:Ipp UTSW 4 116515467 missense probably damaging 1.00
R0669:Ipp UTSW 4 116537876 missense probably damaging 1.00
R1121:Ipp UTSW 4 116520675 missense probably benign 0.00
R1394:Ipp UTSW 4 116537912 nonsense probably null
R1738:Ipp UTSW 4 116530421 missense probably benign 0.00
R2021:Ipp UTSW 4 116515368 missense probably benign 0.26
R3103:Ipp UTSW 4 116524249 missense possibly damaging 0.65
R4372:Ipp UTSW 4 116515363 missense possibly damaging 0.90
R4439:Ipp UTSW 4 116515077 missense probably benign 0.00
R4571:Ipp UTSW 4 116530458 missense probably damaging 1.00
R5134:Ipp UTSW 4 116515457 missense possibly damaging 0.65
R5503:Ipp UTSW 4 116537938 nonsense probably null
R5519:Ipp UTSW 4 116510767 missense possibly damaging 0.76
R5768:Ipp UTSW 4 116510770 missense probably damaging 1.00
R6867:Ipp UTSW 4 116510409 splice site probably null
R7575:Ipp UTSW 4 116532644 missense probably benign 0.20
R7851:Ipp UTSW 4 116515475 nonsense probably null
R7992:Ipp UTSW 4 116524256 missense probably damaging 1.00
R8069:Ipp UTSW 4 116510856 missense probably benign 0.11
Z1176:Ipp UTSW 4 116537885 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AACACCAACGATGAGGGTGTTTTC -3'
(R):5'- GATGGCCTTGCATATTAGTAATACC -3'

Sequencing Primer
(F):5'- CACTATTTAGTCCAGGATGGCCTAG -3'
(R):5'- GCCTTGCATATTAGTAATACCTTCAG -3'
Posted On2016-11-08