Mutagenetix > Incidental Mutations

Incidental Mutation 'R5640:Pde3a'

440601

Institutional Source

Beutler Lab

Gene Symbol

Pde3a

Ensembl Gene

ENSMUSG00000041741

Gene Name

phosphodiesterase 3A, cGMP inhibited

Synonyms

A930022O17Rik

MMRRC Submission

043289-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R5640 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141249269-141507448 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141483915 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 734 (E734G)

Ref Sequence

ENSEMBL: ENSMUSP00000038749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043259]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043259
AA Change: E734G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: E734G

Domain	Start	End	E-Value	Type
low complexity region	29	43	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	93	102	N/A	INTRINSIC
low complexity region	103	121	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
transmembrane domain	230	252	N/A	INTRINSIC
low complexity region	419	445	N/A	INTRINSIC
low complexity region	520	544	N/A	INTRINSIC
HDc	749	964	3.76e-4	SMART
low complexity region	1028	1056	N/A	INTRINSIC
low complexity region	1114	1133	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	A	G	11: 105,970,685	Y220C	probably damaging	Het
Actl6a	A	G	3: 32,718,050	T170A	probably damaging	Het
Adamts8	T	C	9: 30,956,500	V540A	probably benign	Het
Aga	T	C	8: 53,511,884	L27P	probably damaging	Het
Agmat	T	A	4: 141,755,823	H189Q	probably damaging	Het
Alx3	C	A	3: 107,600,661	T162K	probably damaging	Het
Armc2	T	A	10: 42,011,898	I30L	possibly damaging	Het
Arntl	C	T	7: 113,308,681	P530L	probably damaging	Het
Atp10d	T	G	5: 72,247,209	Y487D	probably damaging	Het
Atp13a4	C	T	16: 29,415,831	M908I	probably damaging	Het
B4galt2	T	G	4: 117,873,998	N322T	probably benign	Het
Brdt	A	T	5: 107,359,308	K525*	probably null	Het
Ces3a	T	A	8: 105,051,745	M246K	probably benign	Het
Chd9	T	A	8: 91,036,562	H2338Q	probably damaging	Het
Cyp3a16	T	A	5: 145,452,823	D244V	possibly damaging	Het
Dhrs9	C	A	2: 69,394,478	A170E	probably damaging	Het
Dlg5	T	C	14: 24,170,461	N550D	probably damaging	Het
Dnah8	C	T	17: 30,803,108	T3894I	probably damaging	Het
Dpys	T	C	15: 39,842,066	H217R	probably damaging	Het
Dpysl2	C	T	14: 66,834,368	V108I	probably benign	Het
Eprs	A	G	1: 185,374,184	T199A	probably benign	Het
Fads1	A	G	19: 10,186,403	D183G	probably damaging	Het
Fam110b	T	G	4: 5,798,689	Y36D	probably damaging	Het
Fbxl21	G	A	13: 56,537,381	D407N	probably benign	Het
Fuca2	G	A	10: 13,507,430		probably null	Het
Gm8251	T	C	1: 44,061,927	I4V	probably benign	Het
Gnas	C	A	2: 174,284,971	R100S	probably benign	Het
Gse1	A	G	8: 120,562,677	H90R	possibly damaging	Het
Hoxc10	G	T	15: 102,967,267	C137F	probably benign	Het
Ipp	T	G	4: 116,520,689	L252R	possibly damaging	Het
Jmjd1c	T	A	10: 67,226,078	S1403R	probably benign	Het
Kif19a	A	G	11: 114,779,215	M79V	probably benign	Het
Lipo4	T	C	19: 33,501,586	T285A	possibly damaging	Het
Lrrc66	A	T	5: 73,608,634	D355E	probably benign	Het
Lrsam1	T	A	2: 32,945,852	Q301L	probably benign	Het
Med6	C	T	12: 81,581,854	R138Q	probably damaging	Het
Nlrc5	A	G	8: 94,475,793	T174A	probably benign	Het
Nrbp1	C	T	5: 31,249,585	R322W	possibly damaging	Het
Olfr1256	T	A	2: 89,835,938	E2D	probably benign	Het
Olfr1338	T	A	4: 118,753,789	T250S	probably benign	Het
Olfr739	C	A	14: 50,424,654	A45D	probably benign	Het
Pnpla7	C	T	2: 25,003,001	T167I	possibly damaging	Het
Pop7	T	C	5: 137,502,059	N4S	possibly damaging	Het
Ppm1h	C	A	10: 122,782,278	P114Q	probably benign	Het
Prdm16	T	C	4: 154,341,910	T473A	probably benign	Het
Prdm6	T	C	18: 53,536,741		probably null	Het
Prkdc	T	G	16: 15,829,769	W3686G	possibly damaging	Het
Ptchd4	C	A	17: 42,503,135	H642Q	possibly damaging	Het
Rad1	A	G	15: 10,495,923	Y228C	possibly damaging	Het
Rgs22	G	A	15: 36,106,955	T56I	probably benign	Het
Rnf135	C	A	11: 80,193,907	H169N	probably benign	Het
Rnft1	C	T	11: 86,486,493	Q128*	probably null	Het
Sez6	T	C	11: 77,973,759		probably benign	Het
Sh3rf3	A	G	10: 58,813,947	S125G	probably benign	Het
Sik2	T	C	9: 50,915,506	E295G	possibly damaging	Het
Themis	A	G	10: 28,863,376	Q614R	probably damaging	Het
Thsd7b	T	A	1: 130,116,671	C1129*	probably null	Het
Tmem68	A	T	4: 3,569,512	F59L	probably benign	Het
Tmem8	C	T	17: 26,118,872	T410I	possibly damaging	Het
Vmn2r107	A	G	17: 20,375,164	T660A	probably damaging	Het
Vwa5b2	G	T	16: 20,597,542	C484F	probably damaging	Het
Zfp418	T	A	7: 7,181,981	C314*	probably null	Het

Other mutations in Pde3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01388:Pde3a	APN	6	141459738	missense	probably damaging	1.00
IGL01400:Pde3a	APN	6	141459228	missense	probably benign	0.02
IGL01752:Pde3a	APN	6	141487613	splice site	probably benign
IGL01819:Pde3a	APN	6	141487537	missense	probably damaging	1.00
IGL02014:Pde3a	APN	6	141459144	missense	probably null	1.00
IGL02119:Pde3a	APN	6	141459803	missense	probably damaging	0.97
IGL02465:Pde3a	APN	6	141249675	missense	possibly damaging	0.53
IGL02677:Pde3a	APN	6	141405172	splice site	probably benign
IGL02961:Pde3a	APN	6	141459700	nonsense	probably null
IGL03034:Pde3a	APN	6	141492400	splice site	probably benign
IGL03142:Pde3a	APN	6	141492299	missense	probably benign	0.01
PIT4305001:Pde3a	UTSW	6	141492310	missense	probably benign	0.04
R0412:Pde3a	UTSW	6	141498684	missense	probably damaging	1.00
R0517:Pde3a	UTSW	6	141498657	nonsense	probably null
R0573:Pde3a	UTSW	6	141492231	missense	probably damaging	1.00
R0621:Pde3a	UTSW	6	141249999	missense	probably damaging	1.00
R0781:Pde3a	UTSW	6	141459316	splice site	probably benign
R1065:Pde3a	UTSW	6	141476732	splice site	probably benign
R1110:Pde3a	UTSW	6	141459316	splice site	probably benign
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1480:Pde3a	UTSW	6	141487574	missense	probably benign	0.17
R1559:Pde3a	UTSW	6	141459098	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141250353	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141487513	missense	probably damaging	1.00
R1902:Pde3a	UTSW	6	141498770	missense	probably benign
R1909:Pde3a	UTSW	6	141250239	missense	probably benign	0.00
R2048:Pde3a	UTSW	6	141489006	splice site	probably benign
R2144:Pde3a	UTSW	6	141490111	missense	probably benign	0.40
R2155:Pde3a	UTSW	6	141483914	missense	possibly damaging	0.70
R2208:Pde3a	UTSW	6	141250347	missense	probably damaging	0.97
R2405:Pde3a	UTSW	6	141481242	missense	probably damaging	1.00
R4592:Pde3a	UTSW	6	141459216	missense	probably benign	0.13
R4677:Pde3a	UTSW	6	141466139	missense	probably benign	0.02
R4803:Pde3a	UTSW	6	141459086	missense	probably damaging	1.00
R4887:Pde3a	UTSW	6	141470942	missense	possibly damaging	0.94
R4999:Pde3a	UTSW	6	141250025	missense	probably benign	0.00
R5055:Pde3a	UTSW	6	141487956	nonsense	probably null
R5181:Pde3a	UTSW	6	141481255	critical splice donor site	probably null
R5694:Pde3a	UTSW	6	141250502	missense	possibly damaging	0.48
R6176:Pde3a	UTSW	6	141498889	missense	possibly damaging	0.96
R6394:Pde3a	UTSW	6	141487511	missense	probably damaging	1.00
R6692:Pde3a	UTSW	6	141479346	missense	probably damaging	1.00
R6968:Pde3a	UTSW	6	141487932	missense	probably damaging	1.00
R7137:Pde3a	UTSW	6	141498746	missense	probably benign	0.26
R7163:Pde3a	UTSW	6	141487544	missense	probably damaging	1.00
R7677:Pde3a	UTSW	6	141250257	missense	probably damaging	1.00
R7754:Pde3a	UTSW	6	141459249	missense	probably benign	0.32
R8037:Pde3a	UTSW	6	141483924	missense	possibly damaging	0.82
R8123:Pde3a	UTSW	6	141466191	missense	probably benign	0.00
R8206:Pde3a	UTSW	6	141487885	missense	probably damaging	1.00
R8262:Pde3a	UTSW	6	141487801	missense	possibly damaging	0.89
R8376:Pde3a	UTSW	6	141481221	missense	possibly damaging	0.50
X0053:Pde3a	UTSW	6	141483969	splice site	probably null
X0062:Pde3a	UTSW	6	141249984	missense	probably damaging	1.00
Z1177:Pde3a	UTSW	6	141250469	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- TCAGGACATGGAAGTCTTCAC -3'
(R):5'- TGCTGTGTGGTGAGTACAACAG -3'

Sequencing Primer
(F):5'- AAGTCTTCACTGTGTTTATTGGAAG -3'
(R):5'- TGGTGAGTACAACAGTCATAGACATC -3'

Posted On

2016-11-08