Incidental Mutation 'R5640:Nlrc5'
ID440608
Institutional Source Beutler Lab
Gene Symbol Nlrc5
Ensembl Gene ENSMUSG00000074151
Gene NameNLR family, CARD domain containing 5
SynonymsAI451557
MMRRC Submission 043289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5640 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94434356-94527272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94475793 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 174 (T174A)
Ref Sequence ENSEMBL: ENSMUSP00000148677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]
Predicted Effect probably benign
Transcript: ENSMUST00000053085
AA Change: T174A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: T174A

DomainStartEndE-ValueType
low complexity region 136 151 N/A INTRINSIC
Pfam:NACHT 223 386 1.8e-32 PFAM
LRR 716 743 6.89e1 SMART
LRR 744 771 9.86e1 SMART
LRR 772 796 1.22e2 SMART
LRR 844 870 2.16e2 SMART
LRR 871 898 1.76e-1 SMART
LRR 1006 1033 1.9e0 SMART
LRR 1034 1061 4.51e1 SMART
low complexity region 1141 1169 N/A INTRINSIC
LRR 1240 1267 2.67e1 SMART
LRR 1273 1295 1.22e1 SMART
low complexity region 1341 1351 N/A INTRINSIC
LRR 1519 1546 5.48e1 SMART
LRR 1547 1574 3.36e1 SMART
LRR 1575 1602 1.69e1 SMART
LRR 1603 1630 8.99e-1 SMART
LRR 1631 1654 5.26e0 SMART
LRR 1659 1686 2.81e0 SMART
LRR 1687 1714 1.6e-4 SMART
LRR 1715 1742 1.06e0 SMART
LRR 1743 1768 8e0 SMART
LRR 1793 1820 2.06e1 SMART
LRR 1821 1848 5.42e-2 SMART
LRR 1849 1876 3.54e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182409
AA Change: T174A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211816
AA Change: T174A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,970,685 Y220C probably damaging Het
Actl6a A G 3: 32,718,050 T170A probably damaging Het
Adamts8 T C 9: 30,956,500 V540A probably benign Het
Aga T C 8: 53,511,884 L27P probably damaging Het
Agmat T A 4: 141,755,823 H189Q probably damaging Het
Alx3 C A 3: 107,600,661 T162K probably damaging Het
Armc2 T A 10: 42,011,898 I30L possibly damaging Het
Arntl C T 7: 113,308,681 P530L probably damaging Het
Atp10d T G 5: 72,247,209 Y487D probably damaging Het
Atp13a4 C T 16: 29,415,831 M908I probably damaging Het
B4galt2 T G 4: 117,873,998 N322T probably benign Het
Brdt A T 5: 107,359,308 K525* probably null Het
Ces3a T A 8: 105,051,745 M246K probably benign Het
Chd9 T A 8: 91,036,562 H2338Q probably damaging Het
Cyp3a16 T A 5: 145,452,823 D244V possibly damaging Het
Dhrs9 C A 2: 69,394,478 A170E probably damaging Het
Dlg5 T C 14: 24,170,461 N550D probably damaging Het
Dnah8 C T 17: 30,803,108 T3894I probably damaging Het
Dpys T C 15: 39,842,066 H217R probably damaging Het
Dpysl2 C T 14: 66,834,368 V108I probably benign Het
Eprs A G 1: 185,374,184 T199A probably benign Het
Fads1 A G 19: 10,186,403 D183G probably damaging Het
Fam110b T G 4: 5,798,689 Y36D probably damaging Het
Fbxl21 G A 13: 56,537,381 D407N probably benign Het
Fuca2 G A 10: 13,507,430 probably null Het
Gm8251 T C 1: 44,061,927 I4V probably benign Het
Gnas C A 2: 174,284,971 R100S probably benign Het
Gse1 A G 8: 120,562,677 H90R possibly damaging Het
Hoxc10 G T 15: 102,967,267 C137F probably benign Het
Ipp T G 4: 116,520,689 L252R possibly damaging Het
Jmjd1c T A 10: 67,226,078 S1403R probably benign Het
Kif19a A G 11: 114,779,215 M79V probably benign Het
Lipo4 T C 19: 33,501,586 T285A possibly damaging Het
Lrrc66 A T 5: 73,608,634 D355E probably benign Het
Lrsam1 T A 2: 32,945,852 Q301L probably benign Het
Med6 C T 12: 81,581,854 R138Q probably damaging Het
Nrbp1 C T 5: 31,249,585 R322W possibly damaging Het
Olfr1256 T A 2: 89,835,938 E2D probably benign Het
Olfr1338 T A 4: 118,753,789 T250S probably benign Het
Olfr739 C A 14: 50,424,654 A45D probably benign Het
Pde3a A G 6: 141,483,915 E734G probably damaging Het
Pnpla7 C T 2: 25,003,001 T167I possibly damaging Het
Pop7 T C 5: 137,502,059 N4S possibly damaging Het
Ppm1h C A 10: 122,782,278 P114Q probably benign Het
Prdm16 T C 4: 154,341,910 T473A probably benign Het
Prdm6 T C 18: 53,536,741 probably null Het
Prkdc T G 16: 15,829,769 W3686G possibly damaging Het
Ptchd4 C A 17: 42,503,135 H642Q possibly damaging Het
Rad1 A G 15: 10,495,923 Y228C possibly damaging Het
Rgs22 G A 15: 36,106,955 T56I probably benign Het
Rnf135 C A 11: 80,193,907 H169N probably benign Het
Rnft1 C T 11: 86,486,493 Q128* probably null Het
Sez6 T C 11: 77,973,759 probably benign Het
Sh3rf3 A G 10: 58,813,947 S125G probably benign Het
Sik2 T C 9: 50,915,506 E295G possibly damaging Het
Themis A G 10: 28,863,376 Q614R probably damaging Het
Thsd7b T A 1: 130,116,671 C1129* probably null Het
Tmem68 A T 4: 3,569,512 F59L probably benign Het
Tmem8 C T 17: 26,118,872 T410I possibly damaging Het
Vmn2r107 A G 17: 20,375,164 T660A probably damaging Het
Vwa5b2 G T 16: 20,597,542 C484F probably damaging Het
Zfp418 T A 7: 7,181,981 C314* probably null Het
Other mutations in Nlrc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nlrc5 APN 8 94502211 splice site probably benign
IGL00232:Nlrc5 APN 8 94484623 critical splice donor site probably null
IGL00324:Nlrc5 APN 8 94521479 missense probably damaging 1.00
IGL02715:Nlrc5 APN 8 94474668 missense probably damaging 1.00
IGL02992:Nlrc5 APN 8 94506573 missense possibly damaging 0.69
IGL03095:Nlrc5 APN 8 94521908 splice site probably benign
IGL03389:Nlrc5 APN 8 94521474 missense probably damaging 1.00
IGL03406:Nlrc5 APN 8 94476855 missense probably benign 0.01
cassis UTSW 8 94476393 nonsense probably null
cowberry UTSW 8 94491525 missense possibly damaging 0.83
lingon UTSW 8 94481860 missense probably damaging 1.00
R0037:Nlrc5 UTSW 8 94489535 missense probably benign 0.00
R0048:Nlrc5 UTSW 8 94474656 missense possibly damaging 0.81
R0092:Nlrc5 UTSW 8 94489594 splice site probably benign
R0506:Nlrc5 UTSW 8 94493125 splice site probably benign
R0548:Nlrc5 UTSW 8 94521783 missense probably null 0.09
R2014:Nlrc5 UTSW 8 94525510 splice site probably benign
R3051:Nlrc5 UTSW 8 94476715 missense probably benign 0.01
R3776:Nlrc5 UTSW 8 94472839 missense possibly damaging 0.48
R3837:Nlrc5 UTSW 8 94511301 splice site probably benign
R4012:Nlrc5 UTSW 8 94475992 missense possibly damaging 0.92
R4367:Nlrc5 UTSW 8 94476564 missense probably damaging 1.00
R4400:Nlrc5 UTSW 8 94494353 missense probably benign 0.08
R4469:Nlrc5 UTSW 8 94520839 missense probably damaging 1.00
R4561:Nlrc5 UTSW 8 94477146 missense probably damaging 1.00
R4584:Nlrc5 UTSW 8 94477275 missense probably damaging 0.96
R4758:Nlrc5 UTSW 8 94512328 missense possibly damaging 0.70
R4834:Nlrc5 UTSW 8 94505485 missense probably benign 0.00
R4896:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5004:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5018:Nlrc5 UTSW 8 94525452 missense probably damaging 1.00
R5115:Nlrc5 UTSW 8 94476819 missense possibly damaging 0.67
R5116:Nlrc5 UTSW 8 94481860 missense probably damaging 1.00
R5126:Nlrc5 UTSW 8 94474671 missense possibly damaging 0.95
R5148:Nlrc5 UTSW 8 94476693 missense probably damaging 1.00
R5224:Nlrc5 UTSW 8 94494316 missense probably benign 0.26
R5527:Nlrc5 UTSW 8 94490416 missense probably damaging 1.00
R5705:Nlrc5 UTSW 8 94475757 missense probably benign 0.00
R5778:Nlrc5 UTSW 8 94479526 missense possibly damaging 0.66
R5830:Nlrc5 UTSW 8 94472914 missense probably damaging 1.00
R5850:Nlrc5 UTSW 8 94521047 missense probably benign 0.00
R5978:Nlrc5 UTSW 8 94488593 missense probably damaging 0.98
R6335:Nlrc5 UTSW 8 94502274 missense probably benign 0.01
R6372:Nlrc5 UTSW 8 94479750 missense probably damaging 0.98
R6486:Nlrc5 UTSW 8 94521299 splice site probably null
R6765:Nlrc5 UTSW 8 94490368 missense probably benign 0.20
R6861:Nlrc5 UTSW 8 94521229 unclassified probably benign
R6869:Nlrc5 UTSW 8 94521955 missense probably benign 0.00
R7134:Nlrc5 UTSW 8 94479722 missense probably damaging 0.99
R7204:Nlrc5 UTSW 8 94491525 missense possibly damaging 0.83
R7231:Nlrc5 UTSW 8 94521805 critical splice donor site probably null
R7309:Nlrc5 UTSW 8 94474042 missense probably benign 0.01
R7368:Nlrc5 UTSW 8 94476393 nonsense probably null
R7497:Nlrc5 UTSW 8 94521970 missense probably damaging 1.00
R7606:Nlrc5 UTSW 8 94477117 missense possibly damaging 0.67
R7611:Nlrc5 UTSW 8 94512648 critical splice donor site probably null
R7810:Nlrc5 UTSW 8 94505144 missense possibly damaging 0.85
R7829:Nlrc5 UTSW 8 94521769 missense probably damaging 1.00
RF021:Nlrc5 UTSW 8 94476888 missense probably benign 0.16
Z1088:Nlrc5 UTSW 8 94504464 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGCTGTGGACTAAAGACAGC -3'
(R):5'- CCGATATGCCAGAGTGGTCTTAC -3'

Sequencing Primer
(F):5'- CAGCAGGATGATCATAGAGCCC -3'
(R):5'- GATATGCCAGAGTGGTCTTACCCATC -3'
Posted On2016-11-08