Incidental Mutation 'R5640:Med6'
ID440625
Institutional Source Beutler Lab
Gene Symbol Med6
Ensembl Gene ENSMUSG00000002679
Gene Namemediator complex subunit 6
Synonyms1500012F11Rik
MMRRC Submission 043289-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R5640 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81573557-81595008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81581854 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 138 (R138Q)
Ref Sequence ENSEMBL: ENSMUSP00000124361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002756] [ENSMUST00000161211] [ENSMUST00000161598] [ENSMUST00000161902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002756
AA Change: R87Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002756
Gene: ENSMUSG00000002679
AA Change: R87Q

DomainStartEndE-ValueType
Pfam:Med6 1 90 9.6e-32 PFAM
low complexity region 165 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159187
Predicted Effect possibly damaging
Transcript: ENSMUST00000161211
AA Change: R138Q

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125156
Gene: ENSMUSG00000002679
AA Change: R138Q

DomainStartEndE-ValueType
Pfam:Med6 13 140 1.8e-46 PFAM
low complexity region 216 227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161598
AA Change: R138Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124361
Gene: ENSMUSG00000002679
AA Change: R138Q

DomainStartEndE-ValueType
Pfam:Med6 13 141 1.3e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161902
AA Change: R87Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125103
Gene: ENSMUSG00000002679
AA Change: R87Q

DomainStartEndE-ValueType
Pfam:Med6 1 90 3.4e-32 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,970,685 Y220C probably damaging Het
Actl6a A G 3: 32,718,050 T170A probably damaging Het
Adamts8 T C 9: 30,956,500 V540A probably benign Het
Aga T C 8: 53,511,884 L27P probably damaging Het
Agmat T A 4: 141,755,823 H189Q probably damaging Het
Alx3 C A 3: 107,600,661 T162K probably damaging Het
Armc2 T A 10: 42,011,898 I30L possibly damaging Het
Arntl C T 7: 113,308,681 P530L probably damaging Het
Atp10d T G 5: 72,247,209 Y487D probably damaging Het
Atp13a4 C T 16: 29,415,831 M908I probably damaging Het
B4galt2 T G 4: 117,873,998 N322T probably benign Het
Brdt A T 5: 107,359,308 K525* probably null Het
Ces3a T A 8: 105,051,745 M246K probably benign Het
Chd9 T A 8: 91,036,562 H2338Q probably damaging Het
Cyp3a16 T A 5: 145,452,823 D244V possibly damaging Het
Dhrs9 C A 2: 69,394,478 A170E probably damaging Het
Dlg5 T C 14: 24,170,461 N550D probably damaging Het
Dnah8 C T 17: 30,803,108 T3894I probably damaging Het
Dpys T C 15: 39,842,066 H217R probably damaging Het
Dpysl2 C T 14: 66,834,368 V108I probably benign Het
Eprs A G 1: 185,374,184 T199A probably benign Het
Fads1 A G 19: 10,186,403 D183G probably damaging Het
Fam110b T G 4: 5,798,689 Y36D probably damaging Het
Fbxl21 G A 13: 56,537,381 D407N probably benign Het
Fuca2 G A 10: 13,507,430 probably null Het
Gm8251 T C 1: 44,061,927 I4V probably benign Het
Gnas C A 2: 174,284,971 R100S probably benign Het
Gse1 A G 8: 120,562,677 H90R possibly damaging Het
Hoxc10 G T 15: 102,967,267 C137F probably benign Het
Ipp T G 4: 116,520,689 L252R possibly damaging Het
Jmjd1c T A 10: 67,226,078 S1403R probably benign Het
Kif19a A G 11: 114,779,215 M79V probably benign Het
Lipo4 T C 19: 33,501,586 T285A possibly damaging Het
Lrrc66 A T 5: 73,608,634 D355E probably benign Het
Lrsam1 T A 2: 32,945,852 Q301L probably benign Het
Nlrc5 A G 8: 94,475,793 T174A probably benign Het
Nrbp1 C T 5: 31,249,585 R322W possibly damaging Het
Olfr1256 T A 2: 89,835,938 E2D probably benign Het
Olfr1338 T A 4: 118,753,789 T250S probably benign Het
Olfr739 C A 14: 50,424,654 A45D probably benign Het
Pde3a A G 6: 141,483,915 E734G probably damaging Het
Pnpla7 C T 2: 25,003,001 T167I possibly damaging Het
Pop7 T C 5: 137,502,059 N4S possibly damaging Het
Ppm1h C A 10: 122,782,278 P114Q probably benign Het
Prdm16 T C 4: 154,341,910 T473A probably benign Het
Prdm6 T C 18: 53,536,741 probably null Het
Prkdc T G 16: 15,829,769 W3686G possibly damaging Het
Ptchd4 C A 17: 42,503,135 H642Q possibly damaging Het
Rad1 A G 15: 10,495,923 Y228C possibly damaging Het
Rgs22 G A 15: 36,106,955 T56I probably benign Het
Rnf135 C A 11: 80,193,907 H169N probably benign Het
Rnft1 C T 11: 86,486,493 Q128* probably null Het
Sez6 T C 11: 77,973,759 probably benign Het
Sh3rf3 A G 10: 58,813,947 S125G probably benign Het
Sik2 T C 9: 50,915,506 E295G possibly damaging Het
Themis A G 10: 28,863,376 Q614R probably damaging Het
Thsd7b T A 1: 130,116,671 C1129* probably null Het
Tmem68 A T 4: 3,569,512 F59L probably benign Het
Tmem8 C T 17: 26,118,872 T410I possibly damaging Het
Vmn2r107 A G 17: 20,375,164 T660A probably damaging Het
Vwa5b2 G T 16: 20,597,542 C484F probably damaging Het
Zfp418 T A 7: 7,181,981 C314* probably null Het
Other mutations in Med6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Med6 APN 12 81579574 missense possibly damaging 0.95
R0607:Med6 UTSW 12 81589024 missense probably damaging 1.00
R2020:Med6 UTSW 12 81573877 missense probably benign
R3946:Med6 UTSW 12 81581851 missense probably damaging 1.00
R4763:Med6 UTSW 12 81582661 missense probably damaging 1.00
R5772:Med6 UTSW 12 81579644 missense probably damaging 1.00
R5786:Med6 UTSW 12 81573959 missense probably null 0.00
R6049:Med6 UTSW 12 81591323 missense probably damaging 1.00
R6663:Med6 UTSW 12 81581875 missense possibly damaging 0.67
R6886:Med6 UTSW 12 81591385 missense probably damaging 1.00
R7127:Med6 UTSW 12 81589000 missense probably damaging 0.97
R7919:Med6 UTSW 12 81573847 nonsense probably null
R8158:Med6 UTSW 12 81573903 missense probably benign 0.00
R8506:Med6 UTSW 12 81594960 start codon destroyed probably null 0.14
Predicted Primers PCR Primer
(F):5'- CGCAATGCCATCACCTTCTG -3'
(R):5'- ATTGAGTCTGCCTGAATAACTACAGTC -3'

Sequencing Primer
(F):5'- GCCATCACCTTCTGAAAAATTAAAAC -3'
(R):5'- ATCCCTTGCAGATACTGAAGG -3'
Posted On2016-11-08