Incidental Mutation 'R5640:Rgs22'
ID440631
Institutional Source Beutler Lab
Gene Symbol Rgs22
Ensembl Gene ENSMUSG00000037627
Gene Nameregulator of G-protein signalling 22
Synonyms
MMRRC Submission 043289-MU
Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5640 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location36009479-36140400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36106955 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 56 (T56I)
Ref Sequence ENSEMBL: ENSMUSP00000134185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172831] [ENSMUST00000174881]
Predicted Effect probably benign
Transcript: ENSMUST00000172831
AA Change: T95I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: T95I

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 173 179 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
RGS 845 973 3.15e-2 SMART
RGS 1014 1134 1.56e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174881
AA Change: T56I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134185
Gene: ENSMUSG00000037627
AA Change: T56I

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
RGS 721 849 3.15e-2 SMART
RGS 890 1010 1.56e-15 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,970,685 Y220C probably damaging Het
Actl6a A G 3: 32,718,050 T170A probably damaging Het
Adamts8 T C 9: 30,956,500 V540A probably benign Het
Aga T C 8: 53,511,884 L27P probably damaging Het
Agmat T A 4: 141,755,823 H189Q probably damaging Het
Alx3 C A 3: 107,600,661 T162K probably damaging Het
Armc2 T A 10: 42,011,898 I30L possibly damaging Het
Arntl C T 7: 113,308,681 P530L probably damaging Het
Atp10d T G 5: 72,247,209 Y487D probably damaging Het
Atp13a4 C T 16: 29,415,831 M908I probably damaging Het
B4galt2 T G 4: 117,873,998 N322T probably benign Het
Brdt A T 5: 107,359,308 K525* probably null Het
Ces3a T A 8: 105,051,745 M246K probably benign Het
Chd9 T A 8: 91,036,562 H2338Q probably damaging Het
Cyp3a16 T A 5: 145,452,823 D244V possibly damaging Het
Dhrs9 C A 2: 69,394,478 A170E probably damaging Het
Dlg5 T C 14: 24,170,461 N550D probably damaging Het
Dnah8 C T 17: 30,803,108 T3894I probably damaging Het
Dpys T C 15: 39,842,066 H217R probably damaging Het
Dpysl2 C T 14: 66,834,368 V108I probably benign Het
Eprs A G 1: 185,374,184 T199A probably benign Het
Fads1 A G 19: 10,186,403 D183G probably damaging Het
Fam110b T G 4: 5,798,689 Y36D probably damaging Het
Fbxl21 G A 13: 56,537,381 D407N probably benign Het
Fuca2 G A 10: 13,507,430 probably null Het
Gm8251 T C 1: 44,061,927 I4V probably benign Het
Gnas C A 2: 174,284,971 R100S probably benign Het
Gse1 A G 8: 120,562,677 H90R possibly damaging Het
Hoxc10 G T 15: 102,967,267 C137F probably benign Het
Ipp T G 4: 116,520,689 L252R possibly damaging Het
Jmjd1c T A 10: 67,226,078 S1403R probably benign Het
Kif19a A G 11: 114,779,215 M79V probably benign Het
Lipo4 T C 19: 33,501,586 T285A possibly damaging Het
Lrrc66 A T 5: 73,608,634 D355E probably benign Het
Lrsam1 T A 2: 32,945,852 Q301L probably benign Het
Med6 C T 12: 81,581,854 R138Q probably damaging Het
Nlrc5 A G 8: 94,475,793 T174A probably benign Het
Nrbp1 C T 5: 31,249,585 R322W possibly damaging Het
Olfr1256 T A 2: 89,835,938 E2D probably benign Het
Olfr1338 T A 4: 118,753,789 T250S probably benign Het
Olfr739 C A 14: 50,424,654 A45D probably benign Het
Pde3a A G 6: 141,483,915 E734G probably damaging Het
Pnpla7 C T 2: 25,003,001 T167I possibly damaging Het
Pop7 T C 5: 137,502,059 N4S possibly damaging Het
Ppm1h C A 10: 122,782,278 P114Q probably benign Het
Prdm16 T C 4: 154,341,910 T473A probably benign Het
Prdm6 T C 18: 53,536,741 probably null Het
Prkdc T G 16: 15,829,769 W3686G possibly damaging Het
Ptchd4 C A 17: 42,503,135 H642Q possibly damaging Het
Rad1 A G 15: 10,495,923 Y228C possibly damaging Het
Rnf135 C A 11: 80,193,907 H169N probably benign Het
Rnft1 C T 11: 86,486,493 Q128* probably null Het
Sez6 T C 11: 77,973,759 probably benign Het
Sh3rf3 A G 10: 58,813,947 S125G probably benign Het
Sik2 T C 9: 50,915,506 E295G possibly damaging Het
Themis A G 10: 28,863,376 Q614R probably damaging Het
Thsd7b T A 1: 130,116,671 C1129* probably null Het
Tmem68 A T 4: 3,569,512 F59L probably benign Het
Tmem8 C T 17: 26,118,872 T410I possibly damaging Het
Vmn2r107 A G 17: 20,375,164 T660A probably damaging Het
Vwa5b2 G T 16: 20,597,542 C484F probably damaging Het
Zfp418 T A 7: 7,181,981 C314* probably null Het
Other mutations in Rgs22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Rgs22 APN 15 36099931 missense possibly damaging 0.93
IGL00594:Rgs22 APN 15 36083631 missense probably benign 0.00
IGL01464:Rgs22 APN 15 36083641 missense possibly damaging 0.90
IGL01686:Rgs22 APN 15 36103835 missense probably benign 0.00
IGL01761:Rgs22 APN 15 36103751 missense probably damaging 0.99
IGL02045:Rgs22 APN 15 36013154 missense probably benign 0.33
IGL02378:Rgs22 APN 15 36103805 missense probably benign 0.00
IGL02490:Rgs22 APN 15 36054847 missense probably damaging 1.00
IGL03219:Rgs22 APN 15 36107048 missense probably damaging 1.00
IGL03229:Rgs22 APN 15 36015779 splice site probably benign
IGL03328:Rgs22 APN 15 36043204 critical splice donor site probably null
3-1:Rgs22 UTSW 15 36100036 missense possibly damaging 0.48
R0254:Rgs22 UTSW 15 36104552 missense probably damaging 0.99
R0463:Rgs22 UTSW 15 36092938 missense probably damaging 1.00
R0467:Rgs22 UTSW 15 36099795 nonsense probably null
R0486:Rgs22 UTSW 15 36092882 missense probably damaging 0.98
R0554:Rgs22 UTSW 15 36054709 missense probably benign 0.10
R0602:Rgs22 UTSW 15 36139872 splice site probably benign
R0906:Rgs22 UTSW 15 36103902 intron probably benign
R1159:Rgs22 UTSW 15 36040693 missense probably damaging 1.00
R1300:Rgs22 UTSW 15 36101762 missense probably benign 0.43
R1439:Rgs22 UTSW 15 36025793 splice site probably benign
R1491:Rgs22 UTSW 15 36092901 missense probably damaging 0.98
R1502:Rgs22 UTSW 15 36080851 missense probably damaging 1.00
R1514:Rgs22 UTSW 15 36013100 missense probably benign 0.00
R1538:Rgs22 UTSW 15 36048776 missense probably damaging 1.00
R1784:Rgs22 UTSW 15 36087436 missense probably damaging 1.00
R1938:Rgs22 UTSW 15 36101804 missense probably benign 0.00
R1972:Rgs22 UTSW 15 36103836 missense probably benign 0.01
R2109:Rgs22 UTSW 15 36099734 nonsense probably null
R2208:Rgs22 UTSW 15 36050232 missense probably benign 0.01
R3696:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3697:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3698:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3879:Rgs22 UTSW 15 36106905 missense possibly damaging 0.52
R4080:Rgs22 UTSW 15 36107076 missense probably damaging 1.00
R4363:Rgs22 UTSW 15 36103874 missense probably damaging 0.99
R4591:Rgs22 UTSW 15 36100136 missense probably benign 0.01
R4673:Rgs22 UTSW 15 36099933 missense probably benign 0.04
R4829:Rgs22 UTSW 15 36103888 missense probably damaging 1.00
R4831:Rgs22 UTSW 15 36050148 missense probably benign 0.00
R4865:Rgs22 UTSW 15 36100212 missense probably damaging 1.00
R4907:Rgs22 UTSW 15 36087424 missense possibly damaging 0.61
R4944:Rgs22 UTSW 15 36025942 missense possibly damaging 0.83
R4975:Rgs22 UTSW 15 36054876 nonsense probably null
R5056:Rgs22 UTSW 15 36050245 splice site probably null
R5126:Rgs22 UTSW 15 36040644 missense probably damaging 0.96
R5138:Rgs22 UTSW 15 36099788 missense probably benign 0.04
R5444:Rgs22 UTSW 15 36015627 missense possibly damaging 0.83
R5507:Rgs22 UTSW 15 36099652 missense probably damaging 0.99
R5969:Rgs22 UTSW 15 36015636 missense probably benign 0.00
R6005:Rgs22 UTSW 15 36010567 missense probably benign 0.39
R6053:Rgs22 UTSW 15 36100007 missense probably benign 0.04
R6134:Rgs22 UTSW 15 36107048 missense probably damaging 1.00
R6230:Rgs22 UTSW 15 36100030 missense probably benign 0.02
R6295:Rgs22 UTSW 15 36087374 missense probably benign 0.00
R6352:Rgs22 UTSW 15 36092921 missense probably damaging 1.00
R6809:Rgs22 UTSW 15 36048764 missense probably damaging 1.00
R6900:Rgs22 UTSW 15 36010747 missense possibly damaging 0.61
R6947:Rgs22 UTSW 15 36103890 critical splice acceptor site probably null
R7102:Rgs22 UTSW 15 36122313 missense probably damaging 1.00
R7126:Rgs22 UTSW 15 36103808 missense probably damaging 0.97
R7263:Rgs22 UTSW 15 36015643 missense possibly damaging 0.86
R7623:Rgs22 UTSW 15 36040710 missense probably benign 0.08
R7732:Rgs22 UTSW 15 36025981 missense probably damaging 1.00
R7748:Rgs22 UTSW 15 36122269 critical splice donor site probably null
R7771:Rgs22 UTSW 15 36050078 missense possibly damaging 0.94
R7835:Rgs22 UTSW 15 36081911 critical splice donor site probably null
R7849:Rgs22 UTSW 15 36099712 missense probably damaging 1.00
R7954:Rgs22 UTSW 15 36082002 missense possibly damaging 0.75
R8384:Rgs22 UTSW 15 36046012 critical splice donor site probably null
R8516:Rgs22 UTSW 15 36010335 makesense not run
RF035:Rgs22 UTSW 15 36010835 critical splice acceptor site probably benign
RF043:Rgs22 UTSW 15 36010836 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GACATTCTGTGTTTAGTGCAATGC -3'
(R):5'- CAGACCTTTCCAGAGGCAATTAG -3'

Sequencing Primer
(F):5'- ATGTACGTATGTGCACCACG -3'
(R):5'- CCAGAGGCAATTAGATTTAACGTAG -3'
Posted On2016-11-08