Incidental Mutation 'R5640:Tmem8'
ID440638
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
MMRRC Submission 043289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5640 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26118872 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 410 (T410I)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025010
AA Change: T410I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: T410I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,970,685 Y220C probably damaging Het
Actl6a A G 3: 32,718,050 T170A probably damaging Het
Adamts8 T C 9: 30,956,500 V540A probably benign Het
Aga T C 8: 53,511,884 L27P probably damaging Het
Agmat T A 4: 141,755,823 H189Q probably damaging Het
Alx3 C A 3: 107,600,661 T162K probably damaging Het
Armc2 T A 10: 42,011,898 I30L possibly damaging Het
Arntl C T 7: 113,308,681 P530L probably damaging Het
Atp10d T G 5: 72,247,209 Y487D probably damaging Het
Atp13a4 C T 16: 29,415,831 M908I probably damaging Het
B4galt2 T G 4: 117,873,998 N322T probably benign Het
Brdt A T 5: 107,359,308 K525* probably null Het
Ces3a T A 8: 105,051,745 M246K probably benign Het
Chd9 T A 8: 91,036,562 H2338Q probably damaging Het
Cyp3a16 T A 5: 145,452,823 D244V possibly damaging Het
Dhrs9 C A 2: 69,394,478 A170E probably damaging Het
Dlg5 T C 14: 24,170,461 N550D probably damaging Het
Dnah8 C T 17: 30,803,108 T3894I probably damaging Het
Dpys T C 15: 39,842,066 H217R probably damaging Het
Dpysl2 C T 14: 66,834,368 V108I probably benign Het
Eprs A G 1: 185,374,184 T199A probably benign Het
Fads1 A G 19: 10,186,403 D183G probably damaging Het
Fam110b T G 4: 5,798,689 Y36D probably damaging Het
Fbxl21 G A 13: 56,537,381 D407N probably benign Het
Fuca2 G A 10: 13,507,430 probably null Het
Gm8251 T C 1: 44,061,927 I4V probably benign Het
Gnas C A 2: 174,284,971 R100S probably benign Het
Gse1 A G 8: 120,562,677 H90R possibly damaging Het
Hoxc10 G T 15: 102,967,267 C137F probably benign Het
Ipp T G 4: 116,520,689 L252R possibly damaging Het
Jmjd1c T A 10: 67,226,078 S1403R probably benign Het
Kif19a A G 11: 114,779,215 M79V probably benign Het
Lipo4 T C 19: 33,501,586 T285A possibly damaging Het
Lrrc66 A T 5: 73,608,634 D355E probably benign Het
Lrsam1 T A 2: 32,945,852 Q301L probably benign Het
Med6 C T 12: 81,581,854 R138Q probably damaging Het
Nlrc5 A G 8: 94,475,793 T174A probably benign Het
Nrbp1 C T 5: 31,249,585 R322W possibly damaging Het
Olfr1256 T A 2: 89,835,938 E2D probably benign Het
Olfr1338 T A 4: 118,753,789 T250S probably benign Het
Olfr739 C A 14: 50,424,654 A45D probably benign Het
Pde3a A G 6: 141,483,915 E734G probably damaging Het
Pnpla7 C T 2: 25,003,001 T167I possibly damaging Het
Pop7 T C 5: 137,502,059 N4S possibly damaging Het
Ppm1h C A 10: 122,782,278 P114Q probably benign Het
Prdm16 T C 4: 154,341,910 T473A probably benign Het
Prdm6 T C 18: 53,536,741 probably null Het
Prkdc T G 16: 15,829,769 W3686G possibly damaging Het
Ptchd4 C A 17: 42,503,135 H642Q possibly damaging Het
Rad1 A G 15: 10,495,923 Y228C possibly damaging Het
Rgs22 G A 15: 36,106,955 T56I probably benign Het
Rnf135 C A 11: 80,193,907 H169N probably benign Het
Rnft1 C T 11: 86,486,493 Q128* probably null Het
Sez6 T C 11: 77,973,759 probably benign Het
Sh3rf3 A G 10: 58,813,947 S125G probably benign Het
Sik2 T C 9: 50,915,506 E295G possibly damaging Het
Themis A G 10: 28,863,376 Q614R probably damaging Het
Thsd7b T A 1: 130,116,671 C1129* probably null Het
Tmem68 A T 4: 3,569,512 F59L probably benign Het
Vmn2r107 A G 17: 20,375,164 T660A probably damaging Het
Vwa5b2 G T 16: 20,597,542 C484F probably damaging Het
Zfp418 T A 7: 7,181,981 C314* probably null Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 unclassified probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3609:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5098:Tmem8 UTSW 17 26118928 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5722:Tmem8 UTSW 17 26120562 frame shift probably null
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6587:Tmem8 UTSW 17 26121564 missense probably benign 0.03
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R7771:Tmem8 UTSW 17 26122073 missense probably damaging 1.00
R8037:Tmem8 UTSW 17 26117535 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCAGCTGAAGAAAATTTGGACC -3'
(R):5'- GCATGATGAGGTTGGCCATG -3'

Sequencing Primer
(F):5'- ACCATGATGAACTTTGGGCTAGC -3'
(R):5'- CCATGTGAGATGAGGCTCTCAG -3'
Posted On2016-11-08