Mutagenetix > Incidental Mutation

Incidental Mutation 'R5641:Dnah7b'

440644

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

LOC227058, Dnahc7b

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R5641 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46105475-46412710 bp(+) (GRCm39)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 46307924 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069293

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187548

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	A	T	16: 14,289,877 (GRCm39)	M1398L	probably benign	Het
Acad12	A	G	5: 121,742,084 (GRCm39)		probably benign	Het
Aldh1a7	T	C	19: 20,693,293 (GRCm39)	I209V	probably benign	Het
Alkal2	G	A	12: 30,937,264 (GRCm39)		probably null	Het
Aqr	A	G	2: 113,979,515 (GRCm39)	F307L	probably damaging	Het
Atp2a2	A	G	5: 122,595,639 (GRCm39)	L932P	probably damaging	Het
Atxn7	T	C	14: 14,013,638 (GRCm38)	M113T	probably damaging	Het
Blzf1	T	A	1: 164,134,038 (GRCm39)	M4L	probably benign	Het
Brca2	C	A	5: 150,480,364 (GRCm39)	S2711R	probably damaging	Het
Bzw1	A	T	1: 58,436,883 (GRCm39)	Q70L	probably damaging	Het
Cd34	T	A	1: 194,630,276 (GRCm39)	I70N	probably benign	Het
Chac1	A	G	2: 119,181,999 (GRCm39)	Y39C	probably damaging	Het
Col6a2	G	C	10: 76,449,112 (GRCm39)	P275A	probably damaging	Het
Crb1	T	A	1: 139,176,627 (GRCm39)	N452I	probably damaging	Het
Ctrc	T	C	4: 141,566,094 (GRCm39)	N188S	probably damaging	Het
Etl4	GGGGAAGAACCGG	GGG	2: 20,811,273 (GRCm39)		probably null	Het
Exoc6	T	A	19: 37,576,081 (GRCm39)		probably null	Het
Gm5616	T	A	9: 48,361,716 (GRCm39)		noncoding transcript	Het
Gm7535	T	C	17: 18,131,788 (GRCm39)		probably benign	Het
Hnrnpr	T	C	4: 136,059,798 (GRCm39)	S200P	probably damaging	Het
Ighg2b	T	C	12: 113,270,767 (GRCm39)	N121S	unknown	Het
Il21	T	A	3: 37,281,917 (GRCm39)	K76*	probably null	Het
Jup	T	A	11: 100,267,632 (GRCm39)	T564S	possibly damaging	Het
Kcns2	G	C	15: 34,839,199 (GRCm39)	R187S	possibly damaging	Het
Klhl18	G	A	9: 110,275,896 (GRCm39)	T84M	probably damaging	Het
Mtor	T	A	4: 148,630,882 (GRCm39)	L2280M	probably damaging	Het
Ncoa6	A	G	2: 155,263,756 (GRCm39)	I226T	probably benign	Het
Nipbl	A	T	15: 8,396,196 (GRCm39)	Y126N	possibly damaging	Het
Nlrp4a	T	A	7: 26,149,589 (GRCm39)	C399S	probably damaging	Het
Nphp3	A	G	9: 103,913,352 (GRCm39)	K54E	probably damaging	Het
Nsun2	T	A	13: 69,771,368 (GRCm39)	V326E	probably benign	Het
Oosp3	T	C	19: 11,674,537 (GRCm39)		probably null	Het
Or4k15b	A	G	14: 50,272,746 (GRCm39)	I38T	probably benign	Het
Pcdhga9	T	C	18: 37,871,301 (GRCm39)	S377P	probably damaging	Het
Pdlim3	A	G	8: 46,368,300 (GRCm39)		probably null	Het
Pla2r1	A	T	2: 60,345,328 (GRCm39)	W343R	probably damaging	Het
Prox2	A	G	12: 85,134,721 (GRCm39)	V520A	probably benign	Het
Rfx3	T	C	19: 27,771,008 (GRCm39)		probably null	Het
Rif1	A	C	2: 52,011,170 (GRCm39)	R2412S	possibly damaging	Het
Rreb1	T	C	13: 38,131,397 (GRCm39)	L1517P	probably benign	Het
Rxfp1	T	C	3: 79,594,199 (GRCm39)	N65S	probably damaging	Het
Sbf2	T	C	7: 110,038,108 (GRCm39)	E399G	probably damaging	Het
Slc36a4	A	C	9: 15,640,098 (GRCm39)		probably null	Het
Slco1a1	A	T	6: 141,885,695 (GRCm39)	M110K	probably damaging	Het
Stat5a	T	A	11: 100,767,634 (GRCm39)	C401S	probably benign	Het
Ticam1	TCACACA	TCACA	17: 56,577,629 (GRCm39)		probably null	Het
Tmem150c	T	C	5: 100,231,523 (GRCm39)	T151A	probably damaging	Het
Ube4a	A	T	9: 44,862,179 (GRCm39)	M173K	probably damaging	Het
Vmn1r188	A	T	13: 22,272,342 (GRCm39)	S99C	probably damaging	Het
Vmn2r70	C	T	7: 85,208,572 (GRCm39)	C635Y	probably damaging	Het
Zfp644	T	C	5: 106,767,461 (GRCm39)	K24E	probably damaging	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46,181,309 (GRCm39)	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46,250,497 (GRCm39)	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46,263,811 (GRCm39)	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46,105,889 (GRCm39)	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46,253,482 (GRCm39)	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46,234,538 (GRCm39)	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46,120,592 (GRCm39)	splice site	probably benign
IGL01392:Dnah7b	APN	1	46,165,948 (GRCm39)	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46,155,460 (GRCm39)	splice site	probably benign
IGL01460:Dnah7b	APN	1	46,178,864 (GRCm39)	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46,307,813 (GRCm39)	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46,397,307 (GRCm39)	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46,397,297 (GRCm39)	nonsense	probably null
IGL01906:Dnah7b	APN	1	46,214,613 (GRCm39)	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46,163,497 (GRCm39)	splice site	probably benign
IGL01989:Dnah7b	APN	1	46,328,694 (GRCm39)	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46,179,035 (GRCm39)	missense	probably benign
IGL02213:Dnah7b	APN	1	46,272,752 (GRCm39)	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46,266,090 (GRCm39)	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46,138,663 (GRCm39)	nonsense	probably null
IGL02381:Dnah7b	APN	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46,273,353 (GRCm39)	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46,234,478 (GRCm39)	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46,162,937 (GRCm39)	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46,155,461 (GRCm39)	splice site	probably benign
IGL02704:Dnah7b	APN	1	46,181,293 (GRCm39)	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46,138,768 (GRCm39)	splice site	probably benign
IGL02745:Dnah7b	APN	1	46,234,189 (GRCm39)	splice site	probably benign
IGL02818:Dnah7b	APN	1	46,329,968 (GRCm39)	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46,158,458 (GRCm39)	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46,221,535 (GRCm39)	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46,124,849 (GRCm39)	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46,158,464 (GRCm39)	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46,412,508 (GRCm39)	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46,252,520 (GRCm39)	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46,262,338 (GRCm39)	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46,258,508 (GRCm39)	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46,162,937 (GRCm39)	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46,246,803 (GRCm39)	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46,173,816 (GRCm39)	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46,280,104 (GRCm39)	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46,316,286 (GRCm39)	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46,275,948 (GRCm39)	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46,179,336 (GRCm39)	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46,258,704 (GRCm39)	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46,280,152 (GRCm39)	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46,379,292 (GRCm39)	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46,138,772 (GRCm39)	splice site	probably benign
R1035:Dnah7b	UTSW	1	46,163,608 (GRCm39)	missense	probably benign
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46,364,970 (GRCm39)	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46,379,280 (GRCm39)	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46,138,669 (GRCm39)	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46,328,816 (GRCm39)	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46,117,753 (GRCm39)	splice site	probably benign
R1484:Dnah7b	UTSW	1	46,176,703 (GRCm39)	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46,216,441 (GRCm39)	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46,105,957 (GRCm39)	missense	unknown
R1607:Dnah7b	UTSW	1	46,329,806 (GRCm39)	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46,392,126 (GRCm39)	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46,214,550 (GRCm39)	nonsense	probably null
R1681:Dnah7b	UTSW	1	46,363,872 (GRCm39)	nonsense	probably null
R1716:Dnah7b	UTSW	1	46,230,943 (GRCm39)	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46,272,919 (GRCm39)	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46,316,265 (GRCm39)	missense	probably damaging	1.00
R1838:Dnah7b	UTSW	1	46,155,337 (GRCm39)	missense	probably benign	0.04
R1898:Dnah7b	UTSW	1	46,275,874 (GRCm39)	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46,281,263 (GRCm39)	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46,181,247 (GRCm39)	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46,281,481 (GRCm39)	nonsense	probably null
R2083:Dnah7b	UTSW	1	46,280,227 (GRCm39)	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46,137,152 (GRCm39)	splice site	probably benign
R2172:Dnah7b	UTSW	1	46,163,672 (GRCm39)	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46,240,344 (GRCm39)	splice site	probably benign
R2247:Dnah7b	UTSW	1	46,316,223 (GRCm39)	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46,273,075 (GRCm39)	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46,402,114 (GRCm39)	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46,234,447 (GRCm39)	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46,178,901 (GRCm39)	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46,246,732 (GRCm39)	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46,227,847 (GRCm39)	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46,221,583 (GRCm39)	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46,307,869 (GRCm39)	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46,392,033 (GRCm39)	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46,339,035 (GRCm39)	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46,282,417 (GRCm39)	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46,176,645 (GRCm39)	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46,272,871 (GRCm39)	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46,120,655 (GRCm39)	missense	probably benign
R4172:Dnah7b	UTSW	1	46,266,106 (GRCm39)	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46,176,578 (GRCm39)	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46,260,932 (GRCm39)	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
R4414:Dnah7b	UTSW	1	46,165,840 (GRCm39)	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46,124,792 (GRCm39)	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46,328,696 (GRCm39)	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46,117,684 (GRCm39)	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46,256,317 (GRCm39)	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46,250,488 (GRCm39)	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46,246,816 (GRCm39)	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46,106,115 (GRCm39)	missense	unknown
R4780:Dnah7b	UTSW	1	46,392,174 (GRCm39)	missense	probably benign
R4828:Dnah7b	UTSW	1	46,167,272 (GRCm39)	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46,395,762 (GRCm39)	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46,234,234 (GRCm39)	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46,120,604 (GRCm39)	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46,240,478 (GRCm39)	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46,329,935 (GRCm39)	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46,272,886 (GRCm39)	missense	probably benign
R5000:Dnah7b	UTSW	1	46,138,663 (GRCm39)	nonsense	probably null
R5005:Dnah7b	UTSW	1	46,281,188 (GRCm39)	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46,226,523 (GRCm39)	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46,221,540 (GRCm39)	nonsense	probably null
R5174:Dnah7b	UTSW	1	46,282,509 (GRCm39)	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46,397,376 (GRCm39)	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46,273,018 (GRCm39)	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46,412,514 (GRCm39)	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46,272,849 (GRCm39)	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46,256,351 (GRCm39)	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46,227,819 (GRCm39)	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46,397,431 (GRCm39)	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46,281,366 (GRCm39)	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46,281,179 (GRCm39)	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46,148,472 (GRCm39)	missense	probably null
R5479:Dnah7b	UTSW	1	46,262,265 (GRCm39)	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46,281,359 (GRCm39)	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46,395,674 (GRCm39)	missense	possibly damaging	0.95
R5659:Dnah7b	UTSW	1	46,392,009 (GRCm39)	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46,273,152 (GRCm39)	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46,181,292 (GRCm39)	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46,230,885 (GRCm39)	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46,376,753 (GRCm39)	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46,260,803 (GRCm39)	missense	probably benign
R5941:Dnah7b	UTSW	1	46,226,450 (GRCm39)	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46,402,147 (GRCm39)	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46,158,558 (GRCm39)	splice site	probably null
R6041:Dnah7b	UTSW	1	46,328,805 (GRCm39)	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46,178,949 (GRCm39)	missense	probably benign
R6049:Dnah7b	UTSW	1	46,124,762 (GRCm39)	missense	probably benign
R6131:Dnah7b	UTSW	1	46,292,626 (GRCm39)	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46,329,863 (GRCm39)	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46,272,745 (GRCm39)	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46,165,828 (GRCm39)	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46,265,048 (GRCm39)	missense	probably benign
R6273:Dnah7b	UTSW	1	46,281,476 (GRCm39)	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46,379,335 (GRCm39)	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46,281,364 (GRCm39)	nonsense	probably null
R6494:Dnah7b	UTSW	1	46,138,591 (GRCm39)	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46,263,902 (GRCm39)	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46,379,377 (GRCm39)	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46,230,948 (GRCm39)	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46,234,280 (GRCm39)	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46,158,428 (GRCm39)	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46,397,398 (GRCm39)	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46,234,299 (GRCm39)	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46,275,969 (GRCm39)	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46,391,973 (GRCm39)	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46,178,870 (GRCm39)	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46,281,302 (GRCm39)	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46,179,126 (GRCm39)	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46,122,914 (GRCm39)	missense	probably benign
R7244:Dnah7b	UTSW	1	46,316,303 (GRCm39)	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46,181,245 (GRCm39)	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46,234,532 (GRCm39)	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46,342,794 (GRCm39)	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46,214,579 (GRCm39)	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46,329,894 (GRCm39)	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46,364,925 (GRCm39)	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46,395,714 (GRCm39)	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46,163,506 (GRCm39)	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46,253,573 (GRCm39)	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46,307,794 (GRCm39)	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46,148,462 (GRCm39)	missense	probably benign
R7676:Dnah7b	UTSW	1	46,273,324 (GRCm39)	nonsense	probably null
R7731:Dnah7b	UTSW	1	46,178,905 (GRCm39)	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46,240,413 (GRCm39)	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46,176,634 (GRCm39)	missense	probably benign
R7807:Dnah7b	UTSW	1	46,253,527 (GRCm39)	missense	probably benign
R7895:Dnah7b	UTSW	1	46,289,110 (GRCm39)	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46,178,838 (GRCm39)	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46,266,163 (GRCm39)	missense	probably benign
R7946:Dnah7b	UTSW	1	46,272,739 (GRCm39)	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46,282,584 (GRCm39)	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46,282,525 (GRCm39)	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46,263,866 (GRCm39)	nonsense	probably null
R8094:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46,272,913 (GRCm39)	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46,292,671 (GRCm39)	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46,395,736 (GRCm39)	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46,179,032 (GRCm39)	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46,214,456 (GRCm39)	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46,395,819 (GRCm39)	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46,227,839 (GRCm39)	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46,329,875 (GRCm39)	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46,138,650 (GRCm39)	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46,155,360 (GRCm39)	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46,214,598 (GRCm39)	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46,221,624 (GRCm39)	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46,392,159 (GRCm39)	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46,162,806 (GRCm39)	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46,273,305 (GRCm39)	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46,230,953 (GRCm39)	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46,280,236 (GRCm39)	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46,292,534 (GRCm39)	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46,262,232 (GRCm39)	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46,282,575 (GRCm39)	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46,173,674 (GRCm39)	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46,266,180 (GRCm39)	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46,181,194 (GRCm39)	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46,330,038 (GRCm39)	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46,361,420 (GRCm39)	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46,272,914 (GRCm39)	nonsense	probably null
R9392:Dnah7b	UTSW	1	46,162,898 (GRCm39)	nonsense	probably null
R9456:Dnah7b	UTSW	1	46,165,953 (GRCm39)	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46,253,564 (GRCm39)	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46,264,956 (GRCm39)	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46,292,621 (GRCm39)	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46,252,544 (GRCm39)	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
RF020:Dnah7b	UTSW	1	46,412,421 (GRCm39)	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46,412,458 (GRCm39)	nonsense	probably null
X0023:Dnah7b	UTSW	1	46,342,737 (GRCm39)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCTGTTTCAGGAATGCAAGAAGG -3'
(R):5'- ACTGTCTGGAAGGTCCTCATTTG -3'

Sequencing Primer
(F):5'- AGGTGGCCTCTGATGATAGACC -3'
(R):5'- CTGCTCTACAGTTCTAGGACAAGAG -3'

Posted On

2016-11-08