Incidental Mutation 'R5641:Prox2'
ID440685
Institutional Source Beutler Lab
Gene Symbol Prox2
Ensembl Gene ENSMUSG00000042320
Gene Nameprospero homeobox 2
Synonyms1700058C01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5641 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85086385-85110759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85087947 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 520 (V520A)
Ref Sequence ENSEMBL: ENSMUSP00000135881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110249] [ENSMUST00000177289]
Predicted Effect probably benign
Transcript: ENSMUST00000110249
AA Change: V520A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105878
Gene: ENSMUSG00000042320
AA Change: V520A

DomainStartEndE-ValueType
low complexity region 132 148 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 381 399 N/A INTRINSIC
Pfam:HPD 435 588 7.9e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177043
Predicted Effect probably benign
Transcript: ENSMUST00000177289
AA Change: V520A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135881
Gene: ENSMUSG00000042320
AA Change: V520A

DomainStartEndE-ValueType
low complexity region 132 148 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 381 399 N/A INTRINSIC
Pfam:HPD 434 591 3.9e-86 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal growth, survival and fertility, with no detectable defects in eye structure or horizontal cell development in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,472,013 M1398L probably benign Het
Acad12 A G 5: 121,604,021 probably benign Het
Aldh1a7 T C 19: 20,715,929 I209V probably benign Het
Alkal2 G A 12: 30,887,265 probably null Het
Aqr A G 2: 114,149,034 F307L probably damaging Het
Atp2a2 A G 5: 122,457,576 L932P probably damaging Het
Atxn7 T C 14: 14,013,638 M113T probably damaging Het
Blzf1 T A 1: 164,306,469 M4L probably benign Het
Brca2 C A 5: 150,556,899 S2711R probably damaging Het
Bzw1 A T 1: 58,397,724 Q70L probably damaging Het
Cd34 T A 1: 194,947,968 I70N probably benign Het
Chac1 A G 2: 119,351,518 Y39C probably damaging Het
Col6a2 G C 10: 76,613,278 P275A probably damaging Het
Crb1 T A 1: 139,248,889 N452I probably damaging Het
Ctrc T C 4: 141,838,783 N188S probably damaging Het
Dnah7b G A 1: 46,268,764 probably null Het
Etl4 GGGGAAGAACCGG GGG 2: 20,806,462 probably null Het
Exoc6 T A 19: 37,587,633 probably null Het
Gm5616 T A 9: 48,450,416 noncoding transcript Het
Gm7535 T C 17: 17,911,526 probably benign Het
Hnrnpr T C 4: 136,332,487 S200P probably damaging Het
Ighg2b T C 12: 113,307,147 N121S unknown Het
Il21 T A 3: 37,227,768 K76* probably null Het
Jup T A 11: 100,376,806 T564S possibly damaging Het
Kcns2 G C 15: 34,839,053 R187S possibly damaging Het
Klhl18 G A 9: 110,446,828 T84M probably damaging Het
Mtor T A 4: 148,546,425 L2280M probably damaging Het
Ncoa6 A G 2: 155,421,836 I226T probably benign Het
Nipbl A T 15: 8,366,712 Y126N possibly damaging Het
Nlrp4a T A 7: 26,450,164 C399S probably damaging Het
Nphp3 A G 9: 104,036,153 K54E probably damaging Het
Nsun2 T A 13: 69,623,249 V326E probably benign Het
Olfr725 A G 14: 50,035,289 I38T probably benign Het
Oosp3 T C 19: 11,697,173 probably null Het
Pcdhga9 T C 18: 37,738,248 S377P probably damaging Het
Pdlim3 A G 8: 45,915,263 probably null Het
Pla2r1 A T 2: 60,514,984 W343R probably damaging Het
Rfx3 T C 19: 27,793,608 probably null Het
Rif1 A C 2: 52,121,158 R2412S possibly damaging Het
Rreb1 T C 13: 37,947,421 L1517P probably benign Het
Rxfp1 T C 3: 79,686,892 N65S probably damaging Het
Sbf2 T C 7: 110,438,901 E399G probably damaging Het
Slc36a4 A C 9: 15,728,802 probably null Het
Slco1a1 A T 6: 141,939,969 M110K probably damaging Het
Stat5a T A 11: 100,876,808 C401S probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem150c T C 5: 100,083,664 T151A probably damaging Het
Ube4a A T 9: 44,950,881 M173K probably damaging Het
Vmn1r188 A T 13: 22,088,172 S99C probably damaging Het
Vmn2r70 C T 7: 85,559,364 C635Y probably damaging Het
Zfp644 T C 5: 106,619,595 K24E probably damaging Het
Other mutations in Prox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Prox2 APN 12 85094778 missense probably benign 0.00
IGL00935:Prox2 APN 12 85087929 missense probably damaging 1.00
IGL01590:Prox2 APN 12 85088071 missense probably damaging 1.00
IGL02153:Prox2 APN 12 85087929 missense probably damaging 1.00
IGL02555:Prox2 APN 12 85095260 nonsense probably null
IGL03038:Prox2 APN 12 85095264 missense possibly damaging 0.91
R2081:Prox2 UTSW 12 85095008 missense probably damaging 0.98
R4285:Prox2 UTSW 12 85094924 missense probably benign 0.00
R4560:Prox2 UTSW 12 85095043 missense probably benign 0.04
R5048:Prox2 UTSW 12 85094341 missense probably damaging 1.00
R5770:Prox2 UTSW 12 85087380 missense probably benign 0.30
R6291:Prox2 UTSW 12 85089646 missense probably damaging 1.00
R6940:Prox2 UTSW 12 85094574 missense probably benign 0.01
R6991:Prox2 UTSW 12 85087391 missense probably benign 0.00
R7752:Prox2 UTSW 12 85088041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGTATTAGAGCCTTCCAGG -3'
(R):5'- GTTCACACAGTTCAACCGCTG -3'

Sequencing Primer
(F):5'- ATTAGAGCCTTCCAGGACTTG -3'
(R):5'- GCTGCATCACCTCCCAGATG -3'
Posted On2016-11-08