Mutagenetix > Incidental Mutation

Incidental Mutation 'V5088:Or2n1d'

44069

Institutional Source

Beutler Lab

Gene Symbol

Or2n1d

Ensembl Gene

ENSMUSG00000096840

Gene Name

olfactory receptor family 2 subfamily N member 1D

Synonyms

Olfr136, MOR256-7, GA_x6K02T2PSCP-2779375-2780313

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

V5088 () of strain 521

Quality Score

200

Status

Not validated

Chromosome

Chromosomal Location

38646050-38646988 bp(+) (GRCm39)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to G at 38646050 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000149856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]

AlphaFold

Q8VG72

Predicted Effect

probably null
Transcript: ENSMUST00000077203
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: M1V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.6e-48	PFAM
Pfam:7tm_1	41	290	7.1e-25	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000208525
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

probably null
Transcript: ENSMUST00000208539
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

probably null
Transcript: ENSMUST00000214035
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

probably null
Transcript: ENSMUST00000216963
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.3%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 7 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	C	T	4: 148,026,233 (GRCm39)	S251F	probably benign	Het
Akap8l	C	G	17: 32,555,713 (GRCm39)		probably null	Het
Ccar2	G	T	14: 70,388,738 (GRCm39)	L158I	probably damaging	Het
Megf11	C	A	9: 64,597,351 (GRCm39)	C674*	probably null	Het
Psme4	A	G	11: 30,801,210 (GRCm39)	E1455G	probably benign	Het
Wdr17	C	T	8: 55,146,131 (GRCm39)	A90T	possibly damaging	Het
Zbtb12	C	A	17: 35,115,277 (GRCm39)	A354E	possibly damaging	Het

Other mutations in Or2n1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01712:Or2n1d	APN	17	38,646,848 (GRCm39)	missense	probably benign	0.00
IGL01787:Or2n1d	APN	17	38,646,470 (GRCm39)	missense	probably damaging	0.98
IGL02480:Or2n1d	APN	17	38,646,314 (GRCm39)	missense	probably benign	0.32
IGL02603:Or2n1d	APN	17	38,646,404 (GRCm39)	missense	probably damaging	1.00
IGL03122:Or2n1d	APN	17	38,646,192 (GRCm39)	missense	probably benign	0.01
BB009:Or2n1d	UTSW	17	38,646,146 (GRCm39)	missense	probably benign	0.01
BB019:Or2n1d	UTSW	17	38,646,146 (GRCm39)	missense	probably benign	0.01
R0295:Or2n1d	UTSW	17	38,646,182 (GRCm39)	missense	probably damaging	1.00
R0684:Or2n1d	UTSW	17	38,646,735 (GRCm39)	missense	probably benign	0.11
R1874:Or2n1d	UTSW	17	38,646,860 (GRCm39)	missense	probably damaging	1.00
R3436:Or2n1d	UTSW	17	38,646,323 (GRCm39)	missense	probably damaging	1.00
R3437:Or2n1d	UTSW	17	38,646,323 (GRCm39)	missense	probably damaging	1.00
R4714:Or2n1d	UTSW	17	38,646,731 (GRCm39)	missense	possibly damaging	0.65
R4715:Or2n1d	UTSW	17	38,646,731 (GRCm39)	missense	possibly damaging	0.65
R4716:Or2n1d	UTSW	17	38,646,731 (GRCm39)	missense	possibly damaging	0.65
R4878:Or2n1d	UTSW	17	38,646,518 (GRCm39)	missense	probably benign
R5296:Or2n1d	UTSW	17	38,646,347 (GRCm39)	nonsense	probably null
R5370:Or2n1d	UTSW	17	38,646,335 (GRCm39)	nonsense	probably null
R5413:Or2n1d	UTSW	17	38,646,515 (GRCm39)	missense	probably benign	0.03
R5988:Or2n1d	UTSW	17	38,646,911 (GRCm39)	missense	probably damaging	1.00
R6156:Or2n1d	UTSW	17	38,646,064 (GRCm39)	missense	probably damaging	0.99
R6550:Or2n1d	UTSW	17	38,646,896 (GRCm39)	missense	possibly damaging	0.65
R7395:Or2n1d	UTSW	17	38,646,755 (GRCm39)	nonsense	probably null
R7417:Or2n1d	UTSW	17	38,646,183 (GRCm39)	missense	probably damaging	1.00
R7746:Or2n1d	UTSW	17	38,646,285 (GRCm39)	missense	probably benign	0.16
R7747:Or2n1d	UTSW	17	38,646,285 (GRCm39)	missense	probably benign	0.16
R7821:Or2n1d	UTSW	17	38,646,855 (GRCm39)	missense	probably benign	0.13
R7932:Or2n1d	UTSW	17	38,646,146 (GRCm39)	missense	probably benign	0.01
R8409:Or2n1d	UTSW	17	38,646,197 (GRCm39)	missense	probably benign	0.09
R8911:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R8912:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R8913:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R8914:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R8968:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9006:Or2n1d	UTSW	17	38,646,723 (GRCm39)	missense	possibly damaging	0.84
R9044:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9110:Or2n1d	UTSW	17	38,646,434 (GRCm39)	missense	probably damaging	1.00
R9155:Or2n1d	UTSW	17	38,646,224 (GRCm39)	missense	probably damaging	0.99
R9279:Or2n1d	UTSW	17	38,646,414 (GRCm39)	missense	probably damaging	0.99
R9289:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9295:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9317:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9318:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9348:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9409:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9410:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9411:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9412:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9413:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9512:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9522:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
R9524:Or2n1d	UTSW	17	38,646,540 (GRCm39)	nonsense	probably null
R9547:Or2n1d	UTSW	17	38,646,341 (GRCm39)	missense	possibly damaging	0.80
R9580:Or2n1d	UTSW	17	38,646,320 (GRCm39)	missense	possibly damaging	0.94
Z1176:Or2n1d	UTSW	17	38,646,243 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTGTAGCAGTGGCTTCATGATCAG -3'
(R):5'- GGTTGACACCAGAATGATGGCGATG -3'

Sequencing Primer
(F):5'- acttttaagcactgtgtaagctc -3'
(R):5'- CAGAATGATGGCGATGTTCCC -3'

Posted On

2013-05-31