Mutagenetix > Incidental Mutation

Incidental Mutation 'R5641:Nipbl'

440692

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4921518A06Rik, 4933421G18Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R5641 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8290617-8444463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8366712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 126 (Y126N)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052965
AA Change: Y126N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: Y126N

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	A	T	16: 14,472,013 (GRCm38)	M1398L	probably benign	Het
Acad12	A	G	5: 121,604,021 (GRCm38)		probably benign	Het
Aldh1a7	T	C	19: 20,715,929 (GRCm38)	I209V	probably benign	Het
Alkal2	G	A	12: 30,887,265 (GRCm38)		probably null	Het
Aqr	A	G	2: 114,149,034 (GRCm38)	F307L	probably damaging	Het
Atp2a2	A	G	5: 122,457,576 (GRCm38)	L932P	probably damaging	Het
Atxn7	T	C	14: 14,013,638 (GRCm38)	M113T	probably damaging	Het
Blzf1	T	A	1: 164,306,469 (GRCm38)	M4L	probably benign	Het
Brca2	C	A	5: 150,556,899 (GRCm38)	S2711R	probably damaging	Het
Bzw1	A	T	1: 58,397,724 (GRCm38)	Q70L	probably damaging	Het
Cd34	T	A	1: 194,947,968 (GRCm38)	I70N	probably benign	Het
Chac1	A	G	2: 119,351,518 (GRCm38)	Y39C	probably damaging	Het
Col6a2	G	C	10: 76,613,278 (GRCm38)	P275A	probably damaging	Het
Crb1	T	A	1: 139,248,889 (GRCm38)	N452I	probably damaging	Het
Ctrc	T	C	4: 141,838,783 (GRCm38)	N188S	probably damaging	Het
Dnah7b	G	A	1: 46,268,764 (GRCm38)		probably null	Het
Etl4	GGGGAAGAACCGG	GGG	2: 20,806,462 (GRCm38)		probably null	Het
Exoc6	T	A	19: 37,587,633 (GRCm38)		probably null	Het
Gm5616	T	A	9: 48,450,416 (GRCm38)		noncoding transcript	Het
Gm7535	T	C	17: 17,911,526 (GRCm38)		probably benign	Het
Hnrnpr	T	C	4: 136,332,487 (GRCm38)	S200P	probably damaging	Het
Ighg2b	T	C	12: 113,307,147 (GRCm38)	N121S	unknown	Het
Il21	T	A	3: 37,227,768 (GRCm38)	K76*	probably null	Het
Jup	T	A	11: 100,376,806 (GRCm38)	T564S	possibly damaging	Het
Kcns2	G	C	15: 34,839,053 (GRCm38)	R187S	possibly damaging	Het
Klhl18	G	A	9: 110,446,828 (GRCm38)	T84M	probably damaging	Het
Mtor	T	A	4: 148,546,425 (GRCm38)	L2280M	probably damaging	Het
Ncoa6	A	G	2: 155,421,836 (GRCm38)	I226T	probably benign	Het
Nlrp4a	T	A	7: 26,450,164 (GRCm38)	C399S	probably damaging	Het
Nphp3	A	G	9: 104,036,153 (GRCm38)	K54E	probably damaging	Het
Nsun2	T	A	13: 69,623,249 (GRCm38)	V326E	probably benign	Het
Oosp3	T	C	19: 11,697,173 (GRCm38)		probably null	Het
Or4k15b	A	G	14: 50,035,289 (GRCm38)	I38T	probably benign	Het
Pcdhga9	T	C	18: 37,738,248 (GRCm38)	S377P	probably damaging	Het
Pdlim3	A	G	8: 45,915,263 (GRCm38)		probably null	Het
Pla2r1	A	T	2: 60,514,984 (GRCm38)	W343R	probably damaging	Het
Prox2	A	G	12: 85,087,947 (GRCm38)	V520A	probably benign	Het
Rfx3	T	C	19: 27,793,608 (GRCm38)		probably null	Het
Rif1	A	C	2: 52,121,158 (GRCm38)	R2412S	possibly damaging	Het
Rreb1	T	C	13: 37,947,421 (GRCm38)	L1517P	probably benign	Het
Rxfp1	T	C	3: 79,686,892 (GRCm38)	N65S	probably damaging	Het
Sbf2	T	C	7: 110,438,901 (GRCm38)	E399G	probably damaging	Het
Slc36a4	A	C	9: 15,728,802 (GRCm38)		probably null	Het
Slco1a1	A	T	6: 141,939,969 (GRCm38)	M110K	probably damaging	Het
Stat5a	T	A	11: 100,876,808 (GRCm38)	C401S	probably benign	Het
Ticam1	TCACACA	TCACA	17: 56,270,629 (GRCm38)		probably null	Het
Tmem150c	T	C	5: 100,083,664 (GRCm38)	T151A	probably damaging	Het
Ube4a	A	T	9: 44,950,881 (GRCm38)	M173K	probably damaging	Het
Vmn1r188	A	T	13: 22,088,172 (GRCm38)	S99C	probably damaging	Het
Vmn2r70	C	T	7: 85,559,364 (GRCm38)	C635Y	probably damaging	Het
Zfp644	T	C	5: 106,619,595 (GRCm38)	K24E	probably damaging	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,366,673 (GRCm38)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,369,474 (GRCm38)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,296,869 (GRCm38)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,350,455 (GRCm38)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,350,497 (GRCm38)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,311,209 (GRCm38)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,350,539 (GRCm38)	missense	probably benign
IGL01723:Nipbl	APN	15	8,335,071 (GRCm38)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,361,821 (GRCm38)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,327,090 (GRCm38)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,359,074 (GRCm38)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,343,574 (GRCm38)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,323,647 (GRCm38)	splice site	probably null
IGL02547:Nipbl	APN	15	8,351,598 (GRCm38)	missense	probably benign
IGL02678:Nipbl	APN	15	8,351,110 (GRCm38)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,295,553 (GRCm38)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,350,314 (GRCm38)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,332,452 (GRCm38)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,338,979 (GRCm38)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,293,085 (GRCm38)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,350,876 (GRCm38)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,360,956 (GRCm38)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,350,732 (GRCm38)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,333,024 (GRCm38)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,300,784 (GRCm38)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,293,115 (GRCm38)	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8,361,737 (GRCm38)	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8,360,956 (GRCm38)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,350,732 (GRCm38)	missense	probably benign
R0422:Nipbl	UTSW	15	8,351,628 (GRCm38)	missense	probably benign
R0486:Nipbl	UTSW	15	8,338,870 (GRCm38)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,303,480 (GRCm38)	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8,361,004 (GRCm38)	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8,293,078 (GRCm38)	splice site	probably null
R0726:Nipbl	UTSW	15	8,351,555 (GRCm38)	missense	probably benign
R0881:Nipbl	UTSW	15	8,307,612 (GRCm38)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,361,718 (GRCm38)	missense	probably benign
R0969:Nipbl	UTSW	15	8,292,228 (GRCm38)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,372,173 (GRCm38)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,350,289 (GRCm38)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,351,280 (GRCm38)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,366,664 (GRCm38)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,302,912 (GRCm38)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,338,551 (GRCm38)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,319,488 (GRCm38)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,343,517 (GRCm38)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,327,132 (GRCm38)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,343,630 (GRCm38)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,343,630 (GRCm38)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,350,287 (GRCm38)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,324,467 (GRCm38)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,311,207 (GRCm38)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,336,919 (GRCm38)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,293,218 (GRCm38)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,351,482 (GRCm38)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,335,006 (GRCm38)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,323,698 (GRCm38)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,311,239 (GRCm38)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,343,592 (GRCm38)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,333,024 (GRCm38)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,295,661 (GRCm38)	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8,358,874 (GRCm38)	missense	probably benign
R3902:Nipbl	UTSW	15	8,350,246 (GRCm38)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,350,534 (GRCm38)	missense	probably benign
R4164:Nipbl	UTSW	15	8,338,934 (GRCm38)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,332,432 (GRCm38)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,359,206 (GRCm38)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,361,861 (GRCm38)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,338,724 (GRCm38)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,366,658 (GRCm38)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,366,658 (GRCm38)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,302,984 (GRCm38)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,365,829 (GRCm38)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,351,497 (GRCm38)	missense	probably benign
R5428:Nipbl	UTSW	15	8,330,296 (GRCm38)	missense	probably benign	0.00
R5643:Nipbl	UTSW	15	8,358,907 (GRCm38)	missense	probably benign
R5644:Nipbl	UTSW	15	8,358,907 (GRCm38)	missense	probably benign
R5681:Nipbl	UTSW	15	8,301,382 (GRCm38)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,324,649 (GRCm38)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,334,844 (GRCm38)	splice site	probably null
R5970:Nipbl	UTSW	15	8,296,818 (GRCm38)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,324,264 (GRCm38)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,295,568 (GRCm38)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,334,906 (GRCm38)	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8,318,383 (GRCm38)	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8,324,580 (GRCm38)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,300,895 (GRCm38)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,300,895 (GRCm38)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,300,784 (GRCm38)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,351,565 (GRCm38)	missense	probably benign
R6707:Nipbl	UTSW	15	8,324,559 (GRCm38)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,322,590 (GRCm38)	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8,303,485 (GRCm38)	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8,292,135 (GRCm38)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,343,606 (GRCm38)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,330,295 (GRCm38)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,295,636 (GRCm38)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,343,493 (GRCm38)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,305,872 (GRCm38)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,293,101 (GRCm38)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,351,526 (GRCm38)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,358,702 (GRCm38)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,296,849 (GRCm38)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,291,487 (GRCm38)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,325,752 (GRCm38)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,311,258 (GRCm38)	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8,311,250 (GRCm38)	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8,359,212 (GRCm38)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,335,044 (GRCm38)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,293,115 (GRCm38)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,335,044 (GRCm38)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,338,741 (GRCm38)	missense	probably benign
R8739:Nipbl	UTSW	15	8,303,420 (GRCm38)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,300,726 (GRCm38)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,361,787 (GRCm38)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,351,620 (GRCm38)	missense	probably benign
R8991:Nipbl	UTSW	15	8,291,513 (GRCm38)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,327,124 (GRCm38)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,338,731 (GRCm38)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,350,856 (GRCm38)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,336,889 (GRCm38)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,291,548 (GRCm38)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,358,934 (GRCm38)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,351,715 (GRCm38)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,323,537 (GRCm38)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,307,882 (GRCm38)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,338,699 (GRCm38)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,338,680 (GRCm38)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,336,952 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCTGCTGTGAATTAACCC -3'
(R):5'- GATGTCCTGTGTCAATTCCTAGTTC -3'

Sequencing Primer
(F):5'- TTAGGCAAGCATTCTGCCAG -3'
(R):5'- CATTCTGGTAGAACAGAACTT -3'

Posted On

2016-11-08