Incidental Mutation 'R5641:Gm7535'
ID440695
Institutional Source Beutler Lab
Gene Symbol Gm7535
Ensembl Gene ENSMUSG00000090957
Gene Namepredicted gene 7535
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R5641 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17911039-17911947 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 17911526 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000164167]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164167
SMART Domains Protein: ENSMUSP00000125897
Gene: ENSMUSG00000090957

DomainStartEndE-ValueType
Pfam:CNDH2_C 15 292 6.7e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231820
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,472,013 M1398L probably benign Het
Acad12 A G 5: 121,604,021 probably benign Het
Aldh1a7 T C 19: 20,715,929 I209V probably benign Het
Alkal2 G A 12: 30,887,265 probably null Het
Aqr A G 2: 114,149,034 F307L probably damaging Het
Atp2a2 A G 5: 122,457,576 L932P probably damaging Het
Atxn7 T C 14: 14,013,638 M113T probably damaging Het
Blzf1 T A 1: 164,306,469 M4L probably benign Het
Brca2 C A 5: 150,556,899 S2711R probably damaging Het
Bzw1 A T 1: 58,397,724 Q70L probably damaging Het
Cd34 T A 1: 194,947,968 I70N probably benign Het
Chac1 A G 2: 119,351,518 Y39C probably damaging Het
Col6a2 G C 10: 76,613,278 P275A probably damaging Het
Crb1 T A 1: 139,248,889 N452I probably damaging Het
Ctrc T C 4: 141,838,783 N188S probably damaging Het
Dnah7b G A 1: 46,268,764 probably null Het
Etl4 GGGGAAGAACCGG GGG 2: 20,806,462 probably null Het
Exoc6 T A 19: 37,587,633 probably null Het
Gm5616 T A 9: 48,450,416 noncoding transcript Het
Hnrnpr T C 4: 136,332,487 S200P probably damaging Het
Ighg2b T C 12: 113,307,147 N121S unknown Het
Il21 T A 3: 37,227,768 K76* probably null Het
Jup T A 11: 100,376,806 T564S possibly damaging Het
Kcns2 G C 15: 34,839,053 R187S possibly damaging Het
Klhl18 G A 9: 110,446,828 T84M probably damaging Het
Mtor T A 4: 148,546,425 L2280M probably damaging Het
Ncoa6 A G 2: 155,421,836 I226T probably benign Het
Nipbl A T 15: 8,366,712 Y126N possibly damaging Het
Nlrp4a T A 7: 26,450,164 C399S probably damaging Het
Nphp3 A G 9: 104,036,153 K54E probably damaging Het
Nsun2 T A 13: 69,623,249 V326E probably benign Het
Olfr725 A G 14: 50,035,289 I38T probably benign Het
Oosp3 T C 19: 11,697,173 probably null Het
Pcdhga9 T C 18: 37,738,248 S377P probably damaging Het
Pdlim3 A G 8: 45,915,263 probably null Het
Pla2r1 A T 2: 60,514,984 W343R probably damaging Het
Prox2 A G 12: 85,087,947 V520A probably benign Het
Rfx3 T C 19: 27,793,608 probably null Het
Rif1 A C 2: 52,121,158 R2412S possibly damaging Het
Rreb1 T C 13: 37,947,421 L1517P probably benign Het
Rxfp1 T C 3: 79,686,892 N65S probably damaging Het
Sbf2 T C 7: 110,438,901 E399G probably damaging Het
Slc36a4 A C 9: 15,728,802 probably null Het
Slco1a1 A T 6: 141,939,969 M110K probably damaging Het
Stat5a T A 11: 100,876,808 C401S probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem150c T C 5: 100,083,664 T151A probably damaging Het
Ube4a A T 9: 44,950,881 M173K probably damaging Het
Vmn1r188 A T 13: 22,088,172 S99C probably damaging Het
Vmn2r70 C T 7: 85,559,364 C635Y probably damaging Het
Zfp644 T C 5: 106,619,595 K24E probably damaging Het
Other mutations in Gm7535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Gm7535 APN 17 17911888 intron probably benign
IGL01663:Gm7535 APN 17 17911357 intron probably benign
R0165:Gm7535 UTSW 17 17911175 intron probably benign
R0335:Gm7535 UTSW 17 17911112 intron probably benign
R1985:Gm7535 UTSW 17 17911538 intron probably benign
R2217:Gm7535 UTSW 17 17911674 intron probably benign
R2218:Gm7535 UTSW 17 17911674 intron probably benign
R4464:Gm7535 UTSW 17 17911662 intron probably benign
R4581:Gm7535 UTSW 17 17911083 intron probably benign
R4887:Gm7535 UTSW 17 17911071 intron probably benign
R5225:Gm7535 UTSW 17 17911547 intron probably benign
R5305:Gm7535 UTSW 17 17911799 intron probably benign
R5658:Gm7535 UTSW 17 17911320 intron probably benign
R5760:Gm7535 UTSW 17 17911818 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGATGGTATCTTCCCAGTCC -3'
(R):5'- ATGCCTATGCTGAACACCCTG -3'

Sequencing Primer
(F):5'- TCCCTGATGCGTTGGCTCAG -3'
(R):5'- TATGCTGAACACCCTGACGGC -3'
Posted On2016-11-08