Incidental Mutation 'R5641:Exoc6'
ID440702
Institutional Source Beutler Lab
Gene Symbol Exoc6
Ensembl Gene ENSMUSG00000053799
Gene Nameexocyst complex component 6
Synonymsmsec15, Sec15l1, 4833405E05Rik, Sec15, hbd
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5641 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location37550418-37683245 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 37587633 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066439]
Predicted Effect probably null
Transcript: ENSMUST00000066439
SMART Domains Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799

DomainStartEndE-ValueType
low complexity region 265 273 N/A INTRINSIC
Pfam:Sec15 456 762 8.1e-109 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,472,013 M1398L probably benign Het
Acad12 A G 5: 121,604,021 probably benign Het
Aldh1a7 T C 19: 20,715,929 I209V probably benign Het
Alkal2 G A 12: 30,887,265 probably null Het
Aqr A G 2: 114,149,034 F307L probably damaging Het
Atp2a2 A G 5: 122,457,576 L932P probably damaging Het
Atxn7 T C 14: 14,013,638 M113T probably damaging Het
Blzf1 T A 1: 164,306,469 M4L probably benign Het
Brca2 C A 5: 150,556,899 S2711R probably damaging Het
Bzw1 A T 1: 58,397,724 Q70L probably damaging Het
Cd34 T A 1: 194,947,968 I70N probably benign Het
Chac1 A G 2: 119,351,518 Y39C probably damaging Het
Col6a2 G C 10: 76,613,278 P275A probably damaging Het
Crb1 T A 1: 139,248,889 N452I probably damaging Het
Ctrc T C 4: 141,838,783 N188S probably damaging Het
Dnah7b G A 1: 46,268,764 probably null Het
Etl4 GGGGAAGAACCGG GGG 2: 20,806,462 probably null Het
Gm5616 T A 9: 48,450,416 noncoding transcript Het
Gm7535 T C 17: 17,911,526 probably benign Het
Hnrnpr T C 4: 136,332,487 S200P probably damaging Het
Ighg2b T C 12: 113,307,147 N121S unknown Het
Il21 T A 3: 37,227,768 K76* probably null Het
Jup T A 11: 100,376,806 T564S possibly damaging Het
Kcns2 G C 15: 34,839,053 R187S possibly damaging Het
Klhl18 G A 9: 110,446,828 T84M probably damaging Het
Mtor T A 4: 148,546,425 L2280M probably damaging Het
Ncoa6 A G 2: 155,421,836 I226T probably benign Het
Nipbl A T 15: 8,366,712 Y126N possibly damaging Het
Nlrp4a T A 7: 26,450,164 C399S probably damaging Het
Nphp3 A G 9: 104,036,153 K54E probably damaging Het
Nsun2 T A 13: 69,623,249 V326E probably benign Het
Olfr725 A G 14: 50,035,289 I38T probably benign Het
Oosp3 T C 19: 11,697,173 probably null Het
Pcdhga9 T C 18: 37,738,248 S377P probably damaging Het
Pdlim3 A G 8: 45,915,263 probably null Het
Pla2r1 A T 2: 60,514,984 W343R probably damaging Het
Prox2 A G 12: 85,087,947 V520A probably benign Het
Rfx3 T C 19: 27,793,608 probably null Het
Rif1 A C 2: 52,121,158 R2412S possibly damaging Het
Rreb1 T C 13: 37,947,421 L1517P probably benign Het
Rxfp1 T C 3: 79,686,892 N65S probably damaging Het
Sbf2 T C 7: 110,438,901 E399G probably damaging Het
Slc36a4 A C 9: 15,728,802 probably null Het
Slco1a1 A T 6: 141,939,969 M110K probably damaging Het
Stat5a T A 11: 100,876,808 C401S probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem150c T C 5: 100,083,664 T151A probably damaging Het
Ube4a A T 9: 44,950,881 M173K probably damaging Het
Vmn1r188 A T 13: 22,088,172 S99C probably damaging Het
Vmn2r70 C T 7: 85,559,364 C635Y probably damaging Het
Zfp644 T C 5: 106,619,595 K24E probably damaging Het
Other mutations in Exoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Exoc6 APN 19 37589876 missense possibly damaging 0.68
IGL01716:Exoc6 APN 19 37682964 missense probably damaging 0.98
IGL02363:Exoc6 APN 19 37608954 missense probably damaging 1.00
IGL02383:Exoc6 APN 19 37578474 missense probably benign
IGL03394:Exoc6 APN 19 37599572 missense probably benign 0.15
australamerican UTSW 19 37598679 critical splice donor site probably null
IGL03046:Exoc6 UTSW 19 37593769 critical splice donor site probably null
R1156:Exoc6 UTSW 19 37682897 missense probably benign 0.05
R1489:Exoc6 UTSW 19 37597120 missense possibly damaging 0.71
R1747:Exoc6 UTSW 19 37639769 splice site probably null
R2125:Exoc6 UTSW 19 37590941 missense probably damaging 1.00
R2863:Exoc6 UTSW 19 37653413 missense probably benign 0.34
R4090:Exoc6 UTSW 19 37571912 missense probably benign
R4666:Exoc6 UTSW 19 37570505 missense probably damaging 0.97
R4674:Exoc6 UTSW 19 37609082 missense probably damaging 1.00
R5382:Exoc6 UTSW 19 37598679 critical splice donor site probably null
R5471:Exoc6 UTSW 19 37599617 missense probably benign 0.30
R5533:Exoc6 UTSW 19 37593770 splice site probably null
R5607:Exoc6 UTSW 19 37578529 missense probably benign 0.01
R5759:Exoc6 UTSW 19 37573741 nonsense probably null
R5889:Exoc6 UTSW 19 37582245 missense probably damaging 1.00
R6592:Exoc6 UTSW 19 37571912 missense probably benign
R6936:Exoc6 UTSW 19 37571863 missense probably benign 0.00
R6988:Exoc6 UTSW 19 37609091 missense probably damaging 1.00
R7088:Exoc6 UTSW 19 37577010 missense probably damaging 0.99
R7162:Exoc6 UTSW 19 37577118 missense probably damaging 0.97
R7948:Exoc6 UTSW 19 37576974 missense probably benign 0.00
R8266:Exoc6 UTSW 19 37577049 missense probably benign 0.00
R8525:Exoc6 UTSW 19 37608992 missense possibly damaging 0.53
RF009:Exoc6 UTSW 19 37571620 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGCATGTGTCCACAC -3'
(R):5'- CCACACAGCATGGGTTTAAGG -3'

Sequencing Primer
(F):5'- TGTCCACACACAAATGCATGTCATG -3'
(R):5'- CACACAGCATGGGTTTAAGGGAAAG -3'
Posted On2016-11-08