Incidental Mutation 'R5642:Tpr'
ID 440708
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Name translocated promoter region, nuclear basket protein
Synonyms 2610029M07Rik
MMRRC Submission 043290-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5642 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 150268589-150325686 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150299569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1147 (S1147P)
Ref Sequence ENSEMBL: ENSMUSP00000112606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
AlphaFold F6ZDS4
Predicted Effect probably damaging
Transcript: ENSMUST00000119161
AA Change: S1147P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: S1147P

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124973
AA Change: S1221P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: S1221P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132522
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,261,319 (GRCm39) E699G probably damaging Het
Ap4e1 T A 2: 126,906,899 (GRCm39) V1053D possibly damaging Het
Apobec1 T A 6: 122,558,456 (GRCm39) I100F probably damaging Het
Atp6v1g3 G T 1: 138,211,480 (GRCm39) K53N probably damaging Het
Bag3 C T 7: 128,147,830 (GRCm39) R482W probably damaging Het
Brme1 C T 8: 84,894,114 (GRCm39) T427I probably damaging Het
Cacna1i A G 15: 80,279,279 (GRCm39) T2007A possibly damaging Het
Cd44 T C 2: 102,731,687 (GRCm39) D2G probably damaging Het
Cdadc1 T A 14: 59,827,372 (GRCm39) I100F possibly damaging Het
Cdh16 A G 8: 105,344,677 (GRCm39) F485L probably damaging Het
Cdhr5 T A 7: 140,849,110 (GRCm39) K817* probably null Het
Cfap46 G T 7: 139,258,493 (GRCm39) P260Q probably damaging Het
Clec11a C T 7: 43,955,832 (GRCm39) E72K possibly damaging Het
Cnr2 C A 4: 135,644,076 (GRCm39) N51K probably damaging Het
Col3a1 T A 1: 45,370,872 (GRCm39) probably benign Het
Cxcr1 G A 1: 74,230,987 (GRCm39) T345M probably damaging Het
Cyp2s1 T C 7: 25,515,744 (GRCm39) probably null Het
Dalrd3 C T 9: 108,449,489 (GRCm39) T474M probably damaging Het
Ddit4 C T 10: 59,787,327 (GRCm39) S3N probably benign Het
Ddx41 T C 13: 55,683,708 (GRCm39) K108E possibly damaging Het
Dnaaf10 A G 11: 17,177,263 (GRCm39) N207S possibly damaging Het
Ece2 A T 16: 20,462,477 (GRCm39) H732L probably benign Het
Etv3 T G 3: 87,443,322 (GRCm39) L302R possibly damaging Het
Fam135b A G 15: 71,333,985 (GRCm39) S1070P probably damaging Het
Fhip1b A T 7: 105,039,089 (GRCm39) I50N probably damaging Het
Gm11567 T A 11: 99,770,437 (GRCm39) I125N unknown Het
Grm3 A G 5: 9,620,536 (GRCm39) L236P probably benign Het
Hip1 T A 5: 135,461,939 (GRCm39) R97* probably null Het
Hoxa5 T C 6: 52,181,197 (GRCm39) Y45C probably damaging Het
Ighg1 T A 12: 113,292,654 (GRCm39) H305L probably damaging Het
Inpp5b T A 4: 124,676,229 (GRCm39) C362S probably benign Het
Kif1c A G 11: 70,599,273 (GRCm39) K391E probably benign Het
Klf9 T C 19: 23,119,246 (GRCm39) V43A probably benign Het
Krt28 T A 11: 99,265,320 (GRCm39) I116F probably damaging Het
Lct A T 1: 128,222,969 (GRCm39) D1439E probably damaging Het
Liph G A 16: 21,784,745 (GRCm39) T284M possibly damaging Het
Lrrc75b T C 10: 75,393,055 (GRCm39) K98R possibly damaging Het
Lypd4 T C 7: 24,564,604 (GRCm39) Q178R probably benign Het
Map1a T A 2: 121,136,524 (GRCm39) S2209T probably damaging Het
Map3k21 C T 8: 126,665,563 (GRCm39) T584I probably benign Het
Map3k6 T C 4: 132,972,855 (GRCm39) V338A probably damaging Het
Mapk8ip3 A T 17: 25,122,285 (GRCm39) V699E possibly damaging Het
Mtarc1 A C 1: 184,543,116 (GRCm39) S71A probably damaging Het
Nckap1l T C 15: 103,363,452 (GRCm39) S53P probably benign Het
Nt5e T C 9: 88,209,740 (GRCm39) M1T probably null Het
Nudt22 T C 19: 6,972,896 (GRCm39) H64R probably damaging Het
Or1o11 A T 17: 37,756,663 (GRCm39) T84S probably damaging Het
Or2t44 A T 11: 58,677,654 (GRCm39) Y198F probably damaging Het
Or2w3 T C 11: 58,557,225 (GRCm39) I280T possibly damaging Het
Or52b1 A T 7: 104,978,772 (GRCm39) V209D probably damaging Het
Or5ac16 A G 16: 59,022,369 (GRCm39) L140P probably damaging Het
Or8k17 T C 2: 86,066,276 (GRCm39) N294S probably damaging Het
Otogl T C 10: 107,722,413 (GRCm39) I314V probably benign Het
Pan2 G T 10: 128,143,969 (GRCm39) E106D probably benign Het
Papss1 T A 3: 131,337,565 (GRCm39) Y554* probably null Het
Pcnx1 T C 12: 81,941,803 (GRCm39) V67A possibly damaging Het
Pdpk1 A C 17: 24,325,829 (GRCm39) Y122* probably null Het
Pkd1l1 A T 11: 8,829,202 (GRCm39) N1463K probably damaging Het
Ptgfrn C A 3: 100,950,678 (GRCm39) M878I probably damaging Het
Ranbp3 G A 17: 57,017,703 (GRCm39) G453E probably benign Het
Rapgef2 T C 3: 79,002,157 (GRCm39) D261G probably damaging Het
Reep2 A G 18: 34,979,271 (GRCm39) S199G probably benign Het
Rnpep G A 1: 135,205,259 (GRCm39) T202I probably damaging Het
Sass6 T A 3: 116,401,145 (GRCm39) probably null Het
Sema3e A G 5: 14,212,257 (GRCm39) D111G probably damaging Het
Slc29a4 A G 5: 142,697,727 (GRCm39) E60G probably damaging Het
Spata31g1 T C 4: 42,971,831 (GRCm39) L388P possibly damaging Het
Spata31h1 T A 10: 82,120,317 (GRCm39) Q4231L probably damaging Het
Sptlc3 T C 2: 139,388,328 (GRCm39) Y107H probably damaging Het
Stx6 T C 1: 155,073,925 (GRCm39) I245T probably benign Het
Syne2 T C 12: 75,965,306 (GRCm39) S774P probably damaging Het
Tbc1d16 T A 11: 119,049,617 (GRCm39) Q293L probably damaging Het
Tbc1d30 T C 10: 121,132,692 (GRCm39) D224G probably damaging Het
Tbc1d32 T A 10: 56,026,973 (GRCm39) N759Y possibly damaging Het
Tdrd12 G T 7: 35,210,725 (GRCm39) A166E probably damaging Het
Tex14 A G 11: 87,405,046 (GRCm39) R653G probably benign Het
Them6 A T 15: 74,593,654 (GRCm39) R171W probably null Het
Tln2 T C 9: 67,203,640 (GRCm39) T489A probably benign Het
Tmem87a A G 2: 120,234,427 (GRCm39) F39L probably benign Het
Toporsl T A 4: 52,611,515 (GRCm39) C469* probably null Het
Trp53bp1 T C 2: 121,067,143 (GRCm39) M528V probably benign Het
Trpm6 T A 19: 18,807,571 (GRCm39) C1039S probably damaging Het
Ttc16 T A 2: 32,665,348 (GRCm39) S5C probably damaging Het
Ttn T C 2: 76,617,412 (GRCm39) Y14607C probably damaging Het
Usp6nl T C 2: 6,435,275 (GRCm39) F345L probably damaging Het
Vmn1r205 C T 13: 22,776,206 (GRCm39) G299R probably benign Het
Vmn2r74 G A 7: 85,606,588 (GRCm39) H253Y probably benign Het
Vps13d A T 4: 144,896,872 (GRCm39) D343E possibly damaging Het
Vwf A G 6: 125,580,381 (GRCm39) E543G Het
Zfat A T 15: 68,052,765 (GRCm39) V343E probably damaging Het
Zfp316 T C 5: 143,249,846 (GRCm39) E139G unknown Het
Zfp943 T A 17: 22,211,813 (GRCm39) C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 (GRCm39) K677E probably benign Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150,299,447 (GRCm39) splice site probably benign
IGL00424:Tpr APN 1 150,274,346 (GRCm39) splice site probably benign
IGL01095:Tpr APN 1 150,285,891 (GRCm39) missense possibly damaging 0.95
IGL01347:Tpr APN 1 150,302,738 (GRCm39) missense probably damaging 1.00
IGL01519:Tpr APN 1 150,306,919 (GRCm39) missense probably benign 0.01
IGL01768:Tpr APN 1 150,320,199 (GRCm39) missense possibly damaging 0.85
IGL01939:Tpr APN 1 150,289,496 (GRCm39) missense possibly damaging 0.82
IGL01988:Tpr APN 1 150,302,750 (GRCm39) splice site probably null
IGL02065:Tpr APN 1 150,289,525 (GRCm39) missense probably benign 0.13
IGL02110:Tpr APN 1 150,311,493 (GRCm39) missense probably damaging 0.97
IGL02311:Tpr APN 1 150,274,404 (GRCm39) missense probably damaging 0.97
IGL02454:Tpr APN 1 150,306,943 (GRCm39) missense probably benign 0.00
IGL02569:Tpr APN 1 150,301,382 (GRCm39) unclassified probably benign
IGL03168:Tpr APN 1 150,284,508 (GRCm39) missense probably benign 0.04
IGL03193:Tpr APN 1 150,315,831 (GRCm39) missense possibly damaging 0.85
IGL03333:Tpr APN 1 150,302,718 (GRCm39) missense probably benign 0.04
gridiron UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
Pouch UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
punt UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
Turf UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
F6893:Tpr UTSW 1 150,269,313 (GRCm39) missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150,315,888 (GRCm39) missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150,279,707 (GRCm39) missense probably benign 0.41
R0085:Tpr UTSW 1 150,293,164 (GRCm39) missense possibly damaging 0.95
R0101:Tpr UTSW 1 150,285,053 (GRCm39) splice site probably benign
R0116:Tpr UTSW 1 150,285,898 (GRCm39) missense probably damaging 0.98
R0136:Tpr UTSW 1 150,306,346 (GRCm39) missense probably benign 0.01
R0207:Tpr UTSW 1 150,293,178 (GRCm39) missense possibly damaging 0.74
R0219:Tpr UTSW 1 150,319,009 (GRCm39) splice site probably null
R0380:Tpr UTSW 1 150,288,698 (GRCm39) missense probably benign 0.27
R0403:Tpr UTSW 1 150,283,165 (GRCm39) splice site probably benign
R0469:Tpr UTSW 1 150,299,418 (GRCm39) frame shift probably null
R0480:Tpr UTSW 1 150,303,992 (GRCm39) missense possibly damaging 0.83
R0514:Tpr UTSW 1 150,278,024 (GRCm39) missense possibly damaging 0.55
R0563:Tpr UTSW 1 150,284,609 (GRCm39) missense probably benign 0.13
R0631:Tpr UTSW 1 150,298,282 (GRCm39) missense probably damaging 0.98
R0685:Tpr UTSW 1 150,309,476 (GRCm39) missense possibly damaging 0.69
R0730:Tpr UTSW 1 150,269,158 (GRCm39) utr 5 prime probably benign
R0739:Tpr UTSW 1 150,283,248 (GRCm39) missense possibly damaging 0.94
R0780:Tpr UTSW 1 150,307,092 (GRCm39) missense probably benign 0.00
R1018:Tpr UTSW 1 150,317,934 (GRCm39) missense possibly damaging 0.53
R1084:Tpr UTSW 1 150,317,912 (GRCm39) missense probably benign 0.18
R1532:Tpr UTSW 1 150,293,751 (GRCm39) missense probably damaging 0.99
R1551:Tpr UTSW 1 150,312,552 (GRCm39) missense probably benign 0.00
R1608:Tpr UTSW 1 150,302,644 (GRCm39) missense probably damaging 0.96
R1759:Tpr UTSW 1 150,305,275 (GRCm39) missense probably benign 0.19
R1817:Tpr UTSW 1 150,295,654 (GRCm39) missense probably damaging 0.98
R1932:Tpr UTSW 1 150,297,414 (GRCm39) missense probably benign 0.00
R1978:Tpr UTSW 1 150,295,658 (GRCm39) missense possibly damaging 0.65
R2031:Tpr UTSW 1 150,317,870 (GRCm39) missense probably benign
R2176:Tpr UTSW 1 150,295,691 (GRCm39) missense possibly damaging 0.56
R2235:Tpr UTSW 1 150,317,843 (GRCm39) missense probably benign 0.33
R2339:Tpr UTSW 1 150,289,525 (GRCm39) missense probably benign 0.01
R2367:Tpr UTSW 1 150,309,479 (GRCm39) missense probably damaging 0.99
R2507:Tpr UTSW 1 150,268,695 (GRCm39) start codon destroyed probably null
R3931:Tpr UTSW 1 150,311,655 (GRCm39) missense probably damaging 1.00
R4320:Tpr UTSW 1 150,299,325 (GRCm39) missense possibly damaging 0.96
R4439:Tpr UTSW 1 150,279,712 (GRCm39) missense probably benign 0.01
R4568:Tpr UTSW 1 150,268,710 (GRCm39) unclassified probably benign
R4644:Tpr UTSW 1 150,299,250 (GRCm39) missense probably benign 0.01
R4665:Tpr UTSW 1 150,320,150 (GRCm39) missense probably damaging 0.97
R4672:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4673:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4735:Tpr UTSW 1 150,317,947 (GRCm39) missense possibly damaging 0.91
R4767:Tpr UTSW 1 150,306,280 (GRCm39) intron probably benign
R4772:Tpr UTSW 1 150,288,864 (GRCm39) missense possibly damaging 0.46
R4815:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign 0.01
R4839:Tpr UTSW 1 150,324,948 (GRCm39) nonsense probably null
R4844:Tpr UTSW 1 150,321,630 (GRCm39) missense possibly damaging 0.86
R4925:Tpr UTSW 1 150,308,316 (GRCm39) missense probably benign 0.00
R4967:Tpr UTSW 1 150,285,810 (GRCm39) missense probably damaging 0.99
R5017:Tpr UTSW 1 150,274,388 (GRCm39) missense probably benign 0.00
R5096:Tpr UTSW 1 150,321,953 (GRCm39) missense probably damaging 0.99
R5353:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5354:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5484:Tpr UTSW 1 150,302,639 (GRCm39) missense probably benign 0.33
R5601:Tpr UTSW 1 150,311,604 (GRCm39) missense possibly damaging 0.75
R5779:Tpr UTSW 1 150,299,292 (GRCm39) missense probably damaging 1.00
R5787:Tpr UTSW 1 150,271,037 (GRCm39) missense probably benign 0.01
R5892:Tpr UTSW 1 150,283,151 (GRCm39) missense probably benign 0.44
R5915:Tpr UTSW 1 150,301,400 (GRCm39) missense probably benign 0.15
R5928:Tpr UTSW 1 150,303,878 (GRCm39) missense probably benign 0.30
R6146:Tpr UTSW 1 150,298,913 (GRCm39) missense possibly damaging 0.83
R6154:Tpr UTSW 1 150,299,567 (GRCm39) missense probably benign 0.00
R6234:Tpr UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
R6263:Tpr UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
R6318:Tpr UTSW 1 150,321,639 (GRCm39) missense possibly damaging 0.93
R6550:Tpr UTSW 1 150,299,728 (GRCm39) missense probably damaging 1.00
R6592:Tpr UTSW 1 150,287,656 (GRCm39) missense possibly damaging 0.83
R6704:Tpr UTSW 1 150,282,259 (GRCm39) missense possibly damaging 0.80
R6716:Tpr UTSW 1 150,290,516 (GRCm39) missense probably damaging 1.00
R6836:Tpr UTSW 1 150,312,424 (GRCm39) splice site probably null
R6886:Tpr UTSW 1 150,299,716 (GRCm39) missense probably benign 0.00
R6894:Tpr UTSW 1 150,312,598 (GRCm39) missense probably benign 0.28
R6928:Tpr UTSW 1 150,284,536 (GRCm39) missense possibly damaging 0.83
R7011:Tpr UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
R7034:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7036:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7183:Tpr UTSW 1 150,282,302 (GRCm39) missense probably damaging 1.00
R7221:Tpr UTSW 1 150,321,929 (GRCm39) missense possibly damaging 0.96
R7223:Tpr UTSW 1 150,315,007 (GRCm39) missense possibly damaging 0.53
R7294:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R7343:Tpr UTSW 1 150,269,245 (GRCm39) missense unknown
R7361:Tpr UTSW 1 150,323,372 (GRCm39) missense possibly damaging 0.73
R7405:Tpr UTSW 1 150,317,878 (GRCm39) missense probably benign 0.02
R7637:Tpr UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
R7720:Tpr UTSW 1 150,305,283 (GRCm39) missense possibly damaging 0.49
R7721:Tpr UTSW 1 150,320,180 (GRCm39) missense probably benign
R7751:Tpr UTSW 1 150,295,646 (GRCm39) missense probably benign 0.17
R7804:Tpr UTSW 1 150,308,310 (GRCm39) missense probably damaging 0.99
R7878:Tpr UTSW 1 150,299,411 (GRCm39) missense possibly damaging 0.67
R7973:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R8013:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign
R8220:Tpr UTSW 1 150,308,164 (GRCm39) missense probably benign 0.05
R8274:Tpr UTSW 1 150,299,230 (GRCm39) splice site probably benign
R8428:Tpr UTSW 1 150,290,564 (GRCm39) missense probably damaging 1.00
R8482:Tpr UTSW 1 150,309,451 (GRCm39) missense probably damaging 1.00
R8699:Tpr UTSW 1 150,293,772 (GRCm39) missense probably damaging 0.99
R8859:Tpr UTSW 1 150,284,597 (GRCm39) missense possibly damaging 0.90
R9119:Tpr UTSW 1 150,279,753 (GRCm39) missense probably damaging 0.99
R9326:Tpr UTSW 1 150,301,407 (GRCm39) missense possibly damaging 0.86
R9618:Tpr UTSW 1 150,321,979 (GRCm39) missense possibly damaging 0.70
R9680:Tpr UTSW 1 150,314,887 (GRCm39) missense probably benign 0.32
R9776:Tpr UTSW 1 150,324,939 (GRCm39) missense probably benign 0.00
X0021:Tpr UTSW 1 150,270,958 (GRCm39) missense probably damaging 1.00
Z1177:Tpr UTSW 1 150,303,986 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGAAAGCAGAATCCCAGTTG -3'
(R):5'- GTGCCTTCCTCATTACTGGG -3'

Sequencing Primer
(F):5'- CAGTTGTTGGAATGTAAAGCATCTTG -3'
(R):5'- TCATTACTGGGCCACTGTAAG -3'
Posted On 2016-11-08