Mutagenetix > Incidental Mutation

Incidental Mutation 'R5642:Tpr'

440708

Institutional Source

Beutler Lab

Gene Symbol

Tpr

Ensembl Gene

ENSMUSG00000006005

Gene Name

translocated promoter region, nuclear basket protein

Synonyms

2610029M07Rik

MMRRC Submission

043290-MU

Accession Numbers

Genbank: NM_133780; MGI: 1922066

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5642 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

150392838-150449935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 150423818 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1147 (S1147P)

Ref Sequence

ENSEMBL: ENSMUSP00000112606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]

AlphaFold

F6ZDS4

Predicted Effect

probably damaging
Transcript: ENSMUST00000119161
AA Change: S1147P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: S1147P

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000124973
AA Change: S1221P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: S1221P

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	24	77	N/A	INTRINSIC
coiled coil region	123	444	N/A	INTRINSIC
coiled coil region	497	589	N/A	INTRINSIC
low complexity region	592	608	N/A	INTRINSIC
coiled coil region	613	678	N/A	INTRINSIC
low complexity region	764	777	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1112	1240	5.1e-37	PFAM
coiled coil region	1289	1495	N/A	INTRINSIC
low complexity region	1682	1698	N/A	INTRINSIC
internal_repeat_5	1703	1750	8.04e-5	PROSPERO
internal_repeat_3	1704	1765	1.07e-5	PROSPERO
low complexity region	1769	1791	N/A	INTRINSIC
low complexity region	1835	1851	N/A	INTRINSIC
internal_repeat_5	1857	1900	8.04e-5	PROSPERO
internal_repeat_6	1887	1911	8.04e-5	PROSPERO
internal_repeat_3	1893	1955	1.07e-5	PROSPERO
internal_repeat_4	1949	1969	4.1e-5	PROSPERO
internal_repeat_1	1967	1993	1.42e-6	PROSPERO
low complexity region	1994	2007	N/A	INTRINSIC
low complexity region	2016	2055	N/A	INTRINSIC
low complexity region	2063	2088	N/A	INTRINSIC
internal_repeat_4	2091	2110	4.1e-5	PROSPERO
internal_repeat_6	2108	2132	8.04e-5	PROSPERO
low complexity region	2133	2152	N/A	INTRINSIC
internal_repeat_2	2158	2209	2.78e-6	PROSPERO
internal_repeat_1	2228	2253	1.42e-6	PROSPERO
internal_repeat_2	2230	2286	2.78e-6	PROSPERO
low complexity region	2313	2325	N/A	INTRINSIC
low complexity region	2337	2351	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2420	2431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132522

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,831	L388P	possibly damaging	Het
4930432K21Rik	C	T	8: 84,167,485	T427I	probably damaging	Het
4932415D10Rik	T	A	10: 82,284,483	Q4231L	probably damaging	Het
Abcc1	A	G	16: 14,443,455	E699G	probably damaging	Het
Ap4e1	T	A	2: 127,064,979	V1053D	possibly damaging	Het
Apobec1	T	A	6: 122,581,497	I100F	probably damaging	Het
Atp6v1g3	G	T	1: 138,283,742	K53N	probably damaging	Het
Bag3	C	T	7: 128,546,106	R482W	probably damaging	Het
Cacna1i	A	G	15: 80,395,078	T2007A	possibly damaging	Het
Cd44	T	C	2: 102,901,342	D2G	probably damaging	Het
Cdadc1	T	A	14: 59,589,923	I100F	possibly damaging	Het
Cdh16	A	G	8: 104,618,045	F485L	probably damaging	Het
Cdhr5	T	A	7: 141,269,197	K817*	probably null	Het
Cfap46	G	T	7: 139,678,577	P260Q	probably damaging	Het
Clec11a	C	T	7: 44,306,408	E72K	possibly damaging	Het
Cnr2	C	A	4: 135,916,765	N51K	probably damaging	Het
Col3a1	T	A	1: 45,331,712		probably benign	Het
Cxcr1	G	A	1: 74,191,828	T345M	probably damaging	Het
Cyp2s1	T	C	7: 25,816,319		probably null	Het
Dalrd3	C	T	9: 108,572,290	T474M	probably damaging	Het
Ddit4	C	T	10: 59,951,505	S3N	probably benign	Het
Ddx41	T	C	13: 55,535,895	K108E	possibly damaging	Het
Ece2	A	T	16: 20,643,727	H732L	probably benign	Het
Etv3	T	G	3: 87,536,015	L302R	possibly damaging	Het
Fam135b	A	G	15: 71,462,136	S1070P	probably damaging	Het
Fam160a2	A	T	7: 105,389,882	I50N	probably damaging	Het
Gm11567	T	A	11: 99,879,611	I125N	unknown	Het
Grm3	A	G	5: 9,570,536	L236P	probably benign	Het
Hip1	T	A	5: 135,433,085	R97*	probably null	Het
Hoxa5	T	C	6: 52,204,217	Y45C	probably damaging	Het
Ighg1	T	A	12: 113,329,034	H305L	probably damaging	Het
Inpp5b	T	A	4: 124,782,436	C362S	probably benign	Het
Kif1c	A	G	11: 70,708,447	K391E	probably benign	Het
Klf9	T	C	19: 23,141,882	V43A	probably benign	Het
Krt28	T	A	11: 99,374,494	I116F	probably damaging	Het
Lct	A	T	1: 128,295,232	D1439E	probably damaging	Het
Liph	G	A	16: 21,965,995	T284M	possibly damaging	Het
Lrrc75b	T	C	10: 75,557,221	K98R	possibly damaging	Het
Lypd4	T	C	7: 24,865,179	Q178R	probably benign	Het
Map1a	T	A	2: 121,306,043	S2209T	probably damaging	Het
Map3k21	C	T	8: 125,938,824	T584I	probably benign	Het
Map3k6	T	C	4: 133,245,544	V338A	probably damaging	Het
Mapk8ip3	A	T	17: 24,903,311	V699E	possibly damaging	Het
Marc1	A	C	1: 184,810,919	S71A	probably damaging	Het
Nckap1l	T	C	15: 103,455,025	S53P	probably benign	Het
Nt5e	T	C	9: 88,327,687	M1T	probably null	Het
Nudt22	T	C	19: 6,995,528	H64R	probably damaging	Het
Olfr1048	T	C	2: 86,235,932	N294S	probably damaging	Het
Olfr108	A	T	17: 37,445,772	T84S	probably damaging	Het
Olfr198	A	G	16: 59,202,006	L140P	probably damaging	Het
Olfr314	A	T	11: 58,786,828	Y198F	probably damaging	Het
Olfr322	T	C	11: 58,666,399	I280T	possibly damaging	Het
Olfr690	A	T	7: 105,329,565	V209D	probably damaging	Het
Otogl	T	C	10: 107,886,552	I314V	probably benign	Het
Pan2	G	T	10: 128,308,100	E106D	probably benign	Het
Papss1	T	A	3: 131,631,804	Y554*	probably null	Het
Pcnx	T	C	12: 81,895,029	V67A	possibly damaging	Het
Pdpk1	A	C	17: 24,106,855	Y122*	probably null	Het
Pkd1l1	A	T	11: 8,879,202	N1463K	probably damaging	Het
Ptgfrn	C	A	3: 101,043,362	M878I	probably damaging	Het
Ranbp3	G	A	17: 56,710,703	G453E	probably benign	Het
Rapgef2	T	C	3: 79,094,850	D261G	probably damaging	Het
Reep2	A	G	18: 34,846,218	S199G	probably benign	Het
Rnpep	G	A	1: 135,277,521	T202I	probably damaging	Het
Sass6	T	A	3: 116,607,496		probably null	Het
Sema3e	A	G	5: 14,162,243	D111G	probably damaging	Het
Slc29a4	A	G	5: 142,711,972	E60G	probably damaging	Het
Sptlc3	T	C	2: 139,546,408	Y107H	probably damaging	Het
Stx6	T	C	1: 155,198,179	I245T	probably benign	Het
Syne2	T	C	12: 75,918,532	S774P	probably damaging	Het
Tbc1d16	T	A	11: 119,158,791	Q293L	probably damaging	Het
Tbc1d30	T	C	10: 121,296,787	D224G	probably damaging	Het
Tbc1d32	T	A	10: 56,150,877	N759Y	possibly damaging	Het
Tdrd12	G	T	7: 35,511,300	A166E	probably damaging	Het
Tex14	A	G	11: 87,514,220	R653G	probably benign	Het
Them6	A	T	15: 74,721,805	R171W	probably null	Het
Tln2	T	C	9: 67,296,358	T489A	probably benign	Het
Tmem87a	A	G	2: 120,403,946	F39L	probably benign	Het
Toporsl	T	A	4: 52,611,515	C469*	probably null	Het
Trp53bp1	T	C	2: 121,236,662	M528V	probably benign	Het
Trpm6	T	A	19: 18,830,207	C1039S	probably damaging	Het
Ttc16	T	A	2: 32,775,336	S5C	probably damaging	Het
Ttn	T	C	2: 76,787,068	Y14607C	probably damaging	Het
Usp6nl	T	C	2: 6,430,464	F345L	probably damaging	Het
Vmn1r205	C	T	13: 22,592,036	G299R	probably benign	Het
Vmn2r74	G	A	7: 85,957,380	H253Y	probably benign	Het
Vps13d	A	T	4: 145,170,302	D343E	possibly damaging	Het
Vwf	A	G	6: 125,603,418	E543G		Het
Wdr92	A	G	11: 17,227,263	N207S	possibly damaging	Het
Zfat	A	T	15: 68,180,916	V343E	probably damaging	Het
Zfp316	T	C	5: 143,264,091	E139G	unknown	Het
Zfp943	T	A	17: 21,992,832	C300S	probably damaging	Het
Zkscan16	A	G	4: 58,957,748	K677E	probably benign	Het

Other mutations in Tpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Tpr	APN	1	150423696	splice site	probably benign
IGL00424:Tpr	APN	1	150398595	splice site	probably benign
IGL01095:Tpr	APN	1	150410140	missense	possibly damaging	0.95
IGL01347:Tpr	APN	1	150426987	missense	probably damaging	1.00
IGL01519:Tpr	APN	1	150431168	missense	probably benign	0.01
IGL01768:Tpr	APN	1	150444448	missense	possibly damaging	0.85
IGL01939:Tpr	APN	1	150413745	missense	possibly damaging	0.82
IGL01988:Tpr	APN	1	150426999	splice site	probably null
IGL02065:Tpr	APN	1	150413774	missense	probably benign	0.13
IGL02110:Tpr	APN	1	150435742	missense	probably damaging	0.97
IGL02311:Tpr	APN	1	150398653	missense	probably damaging	0.97
IGL02454:Tpr	APN	1	150431192	missense	probably benign	0.00
IGL02569:Tpr	APN	1	150425631	unclassified	probably benign
IGL03168:Tpr	APN	1	150408757	missense	probably benign	0.04
IGL03193:Tpr	APN	1	150440080	missense	possibly damaging	0.85
IGL03333:Tpr	APN	1	150426967	missense	probably benign	0.04
gridiron	UTSW	1	150423516	missense	probably damaging	1.00
Pouch	UTSW	1	150433772	missense	probably damaging	1.00
punt	UTSW	1	150418039	missense	probably benign	0.02
Turf	UTSW	1	150442245	critical splice donor site	probably null
F6893:Tpr	UTSW	1	150393562	missense	possibly damaging	0.84
PIT4305001:Tpr	UTSW	1	150440137	missense	possibly damaging	0.85
PIT4469001:Tpr	UTSW	1	150403956	missense	probably benign	0.41
R0085:Tpr	UTSW	1	150417413	missense	possibly damaging	0.95
R0101:Tpr	UTSW	1	150409302	splice site	probably benign
R0116:Tpr	UTSW	1	150410147	missense	probably damaging	0.98
R0136:Tpr	UTSW	1	150430595	missense	probably benign	0.01
R0207:Tpr	UTSW	1	150417427	missense	possibly damaging	0.74
R0219:Tpr	UTSW	1	150443258	splice site	probably null
R0380:Tpr	UTSW	1	150412947	missense	probably benign	0.27
R0403:Tpr	UTSW	1	150407414	splice site	probably benign
R0469:Tpr	UTSW	1	150423667	frame shift	probably null
R0480:Tpr	UTSW	1	150428241	missense	possibly damaging	0.83
R0514:Tpr	UTSW	1	150402273	missense	possibly damaging	0.55
R0563:Tpr	UTSW	1	150408858	missense	probably benign	0.13
R0631:Tpr	UTSW	1	150422531	missense	probably damaging	0.98
R0685:Tpr	UTSW	1	150433725	missense	possibly damaging	0.69
R0730:Tpr	UTSW	1	150393407	utr 5 prime	probably benign
R0739:Tpr	UTSW	1	150407497	missense	possibly damaging	0.94
R0780:Tpr	UTSW	1	150431341	missense	probably benign	0.00
R1018:Tpr	UTSW	1	150442183	missense	possibly damaging	0.53
R1084:Tpr	UTSW	1	150442161	missense	probably benign	0.18
R1532:Tpr	UTSW	1	150418000	missense	probably damaging	0.99
R1551:Tpr	UTSW	1	150436801	missense	probably benign	0.00
R1608:Tpr	UTSW	1	150426893	missense	probably damaging	0.96
R1759:Tpr	UTSW	1	150429524	missense	probably benign	0.19
R1817:Tpr	UTSW	1	150419903	missense	probably damaging	0.98
R1932:Tpr	UTSW	1	150421663	missense	probably benign	0.00
R1978:Tpr	UTSW	1	150419907	missense	possibly damaging	0.65
R2031:Tpr	UTSW	1	150442119	missense	probably benign
R2176:Tpr	UTSW	1	150419940	missense	possibly damaging	0.56
R2235:Tpr	UTSW	1	150442092	missense	probably benign	0.33
R2339:Tpr	UTSW	1	150413774	missense	probably benign	0.01
R2367:Tpr	UTSW	1	150433728	missense	probably damaging	0.99
R2507:Tpr	UTSW	1	150392944	start codon destroyed	probably null
R3931:Tpr	UTSW	1	150435904	missense	probably damaging	1.00
R4320:Tpr	UTSW	1	150423574	missense	possibly damaging	0.96
R4439:Tpr	UTSW	1	150403961	missense	probably benign	0.01
R4568:Tpr	UTSW	1	150392959	unclassified	probably benign
R4644:Tpr	UTSW	1	150423499	missense	probably benign	0.01
R4665:Tpr	UTSW	1	150444399	missense	probably damaging	0.97
R4672:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4673:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4735:Tpr	UTSW	1	150442196	missense	possibly damaging	0.91
R4767:Tpr	UTSW	1	150430529	intron	probably benign
R4772:Tpr	UTSW	1	150413113	missense	possibly damaging	0.46
R4815:Tpr	UTSW	1	150398608	missense	probably benign	0.01
R4839:Tpr	UTSW	1	150449197	nonsense	probably null
R4844:Tpr	UTSW	1	150445879	missense	possibly damaging	0.86
R4925:Tpr	UTSW	1	150432565	missense	probably benign	0.00
R4967:Tpr	UTSW	1	150410059	missense	probably damaging	0.99
R5017:Tpr	UTSW	1	150398637	missense	probably benign	0.00
R5096:Tpr	UTSW	1	150446202	missense	probably damaging	0.99
R5353:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5354:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5484:Tpr	UTSW	1	150426888	missense	probably benign	0.33
R5601:Tpr	UTSW	1	150435853	missense	possibly damaging	0.75
R5779:Tpr	UTSW	1	150423541	missense	probably damaging	1.00
R5787:Tpr	UTSW	1	150395286	missense	probably benign	0.01
R5892:Tpr	UTSW	1	150407400	missense	probably benign	0.44
R5915:Tpr	UTSW	1	150425649	missense	probably benign	0.15
R5928:Tpr	UTSW	1	150428127	missense	probably benign	0.30
R6146:Tpr	UTSW	1	150423162	missense	possibly damaging	0.83
R6154:Tpr	UTSW	1	150423816	missense	probably benign	0.00
R6234:Tpr	UTSW	1	150418039	missense	probably benign	0.02
R6263:Tpr	UTSW	1	150442245	critical splice donor site	probably null
R6318:Tpr	UTSW	1	150445888	missense	possibly damaging	0.93
R6550:Tpr	UTSW	1	150423977	missense	probably damaging	1.00
R6592:Tpr	UTSW	1	150411905	missense	possibly damaging	0.83
R6704:Tpr	UTSW	1	150406508	missense	possibly damaging	0.80
R6716:Tpr	UTSW	1	150414765	missense	probably damaging	1.00
R6836:Tpr	UTSW	1	150436673	splice site	probably null
R6886:Tpr	UTSW	1	150423965	missense	probably benign	0.00
R6894:Tpr	UTSW	1	150436847	missense	probably benign	0.28
R6928:Tpr	UTSW	1	150408785	missense	possibly damaging	0.83
R7011:Tpr	UTSW	1	150433772	missense	probably damaging	1.00
R7034:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7036:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7183:Tpr	UTSW	1	150406551	missense	probably damaging	1.00
R7221:Tpr	UTSW	1	150446178	missense	possibly damaging	0.96
R7223:Tpr	UTSW	1	150439256	missense	possibly damaging	0.53
R7294:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R7343:Tpr	UTSW	1	150393494	missense	unknown
R7361:Tpr	UTSW	1	150447621	missense	possibly damaging	0.73
R7405:Tpr	UTSW	1	150442127	missense	probably benign	0.02
R7637:Tpr	UTSW	1	150423516	missense	probably damaging	1.00
R7720:Tpr	UTSW	1	150429532	missense	possibly damaging	0.49
R7721:Tpr	UTSW	1	150444429	missense	probably benign
R7751:Tpr	UTSW	1	150419895	missense	probably benign	0.17
R7804:Tpr	UTSW	1	150432559	missense	probably damaging	0.99
R7878:Tpr	UTSW	1	150423660	missense	possibly damaging	0.67
R7973:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R8013:Tpr	UTSW	1	150398608	missense	probably benign
R8220:Tpr	UTSW	1	150432413	missense	probably benign	0.05
R8274:Tpr	UTSW	1	150423479	splice site	probably benign
R8428:Tpr	UTSW	1	150414813	missense	probably damaging	1.00
R8482:Tpr	UTSW	1	150433700	missense	probably damaging	1.00
R8699:Tpr	UTSW	1	150418021	missense	probably damaging	0.99
R8859:Tpr	UTSW	1	150408846	missense	possibly damaging	0.90
R9119:Tpr	UTSW	1	150404002	missense	probably damaging	0.99
R9326:Tpr	UTSW	1	150425656	missense	possibly damaging	0.86
R9618:Tpr	UTSW	1	150446228	missense	possibly damaging	0.70
R9680:Tpr	UTSW	1	150439136	missense	probably benign	0.32
R9776:Tpr	UTSW	1	150449188	missense	probably benign	0.00
X0021:Tpr	UTSW	1	150395207	missense	probably damaging	1.00
Z1177:Tpr	UTSW	1	150428235	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCAGAAAGCAGAATCCCAGTTG -3'
(R):5'- GTGCCTTCCTCATTACTGGG -3'

Sequencing Primer
(F):5'- CAGTTGTTGGAATGTAAAGCATCTTG -3'
(R):5'- TCATTACTGGGCCACTGTAAG -3'

Posted On

2016-11-08