Incidental Mutation 'R5642:Cd44'
ID440716
Institutional Source Beutler Lab
Gene Symbol Cd44
Ensembl Gene ENSMUSG00000005087
Gene NameCD44 antigen
SynonymsPgp-1, HERMES, Ly-24
MMRRC Submission 043290-MU
Accession Numbers

Genbank: NM_009851; MGI: 88338

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R5642 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location102811141-102901665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102901342 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000106825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005218] [ENSMUST00000060516] [ENSMUST00000099673] [ENSMUST00000111190] [ENSMUST00000111191] [ENSMUST00000111192] [ENSMUST00000111194] [ENSMUST00000111198]
Predicted Effect probably damaging
Transcript: ENSMUST00000005218
AA Change: D2G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005218
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 251 276 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
PDB:2ZPY|B 710 729 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000060516
AA Change: D2G

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062330
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 229 239 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
PDB:2ZPY|B 510 529 1e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083749
Predicted Effect possibly damaging
Transcript: ENSMUST00000099673
AA Change: D2G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097265
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
PDB:2ZPY|B 295 314 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000111190
AA Change: D2G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106821
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 324 337 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
PDB:2ZPY|B 394 413 8e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000111191
AA Change: D2G

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106822
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
PDB:2ZPY|B 428 447 9e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000111192
AA Change: D2G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106823
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 294 307 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
PDB:2ZPY|B 364 383 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000111194
AA Change: D2G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106825
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
PDB:2ZPY|B 507 526 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000111198
AA Change: D2G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106829
Gene: ENSMUSG00000005087
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
PDB:2ZPY|B 587 606 1e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124624
Meta Mutation Damage Score 0.2048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(4) Targeted, other(3)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ddx41 T C 13: 55,535,895 K108E possibly damaging Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Inpp5b T A 4: 124,782,436 C362S probably benign Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map1a T A 2: 121,306,043 S2209T probably damaging Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Slc29a4 A G 5: 142,711,972 E60G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Tmem87a A G 2: 120,403,946 F39L probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trp53bp1 T C 2: 121,236,662 M528V probably benign Het
Trpm6 T A 19: 18,830,207 C1039S probably damaging Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Cd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Cd44 APN 2 102855947 missense possibly damaging 0.73
IGL01087:Cd44 APN 2 102822262 missense probably damaging 1.00
IGL01413:Cd44 APN 2 102814287 missense probably damaging 0.99
IGL01830:Cd44 APN 2 102842258 splice site probably benign
IGL02221:Cd44 APN 2 102846513 missense probably benign 0.01
IGL02271:Cd44 APN 2 102831387 missense possibly damaging 0.93
IGL02552:Cd44 APN 2 102848731 missense probably benign 0.01
IGL02861:Cd44 APN 2 102832481 critical splice donor site probably null
IGL03309:Cd44 APN 2 102814177 missense probably damaging 1.00
IGL03352:Cd44 APN 2 102845414 intron probably benign
Jialin UTSW 2 102865370 missense probably damaging 0.99
Kale UTSW 2 102824303 missense probably damaging 0.99
N/A - 535:Cd44 UTSW 2 102814189 missense possibly damaging 0.50
R0488:Cd44 UTSW 2 102834219 splice site probably benign
R1441:Cd44 UTSW 2 102846418 missense probably damaging 0.99
R1482:Cd44 UTSW 2 102831383 missense probably damaging 1.00
R1497:Cd44 UTSW 2 102842955 splice site probably null
R1803:Cd44 UTSW 2 102834252 missense probably damaging 1.00
R1952:Cd44 UTSW 2 102853087 missense probably damaging 0.98
R2093:Cd44 UTSW 2 102814284 missense probably damaging 1.00
R2180:Cd44 UTSW 2 102828610 missense possibly damaging 0.66
R2425:Cd44 UTSW 2 102861586 missense probably damaging 1.00
R3687:Cd44 UTSW 2 102901350 splice site probably null
R3820:Cd44 UTSW 2 102901393 splice site probably null
R3821:Cd44 UTSW 2 102901393 splice site probably null
R3822:Cd44 UTSW 2 102901393 splice site probably null
R4060:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R4633:Cd44 UTSW 2 102853047 missense possibly damaging 0.86
R4647:Cd44 UTSW 2 102837929 missense possibly damaging 0.68
R4780:Cd44 UTSW 2 102861565 missense probably damaging 1.00
R5087:Cd44 UTSW 2 102831354 missense possibly damaging 0.83
R5118:Cd44 UTSW 2 102865370 missense probably damaging 0.99
R5449:Cd44 UTSW 2 102832546 missense probably damaging 1.00
R5928:Cd44 UTSW 2 102824303 missense probably damaging 0.99
R5995:Cd44 UTSW 2 102861670 missense probably damaging 1.00
R5999:Cd44 UTSW 2 102845397 missense probably benign 0.42
R7050:Cd44 UTSW 2 102814137 missense probably damaging 0.99
R7350:Cd44 UTSW 2 102834262 missense probably benign 0.19
R7797:Cd44 UTSW 2 102848734 missense probably benign 0.34
R7866:Cd44 UTSW 2 102842259 critical splice donor site probably null
R8138:Cd44 UTSW 2 102832497 missense probably benign 0.00
R8185:Cd44 UTSW 2 102824320 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCTTTGCTAGCCCAATTCAC -3'
(R):5'- TTGGCTGCTTAGTCACAGC -3'

Sequencing Primer
(F):5'- TTGCTAGCCCAATTCACTACAG -3'
(R):5'- TAGTCACAGCCCCCTCG -3'
Posted On2016-11-08