Mutagenetix > Incidental Mutation

Incidental Mutation 'R5642:Cd44'

440716

Institutional Source

Beutler Lab

Gene Symbol

Cd44

Ensembl Gene

ENSMUSG00000005087

Gene Name

CD44 antigen

Synonyms

Pgp-1, HERMES, Ly-24

MMRRC Submission

043290-MU

Accession Numbers

Genbank: NM_009851; MGI: 88338

Essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R5642 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102811141-102901665 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102901342 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2 (D2G)

Ref Sequence

ENSEMBL: ENSMUSP00000106825 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005218] [ENSMUST00000060516] [ENSMUST00000099673] [ENSMUST00000111190] [ENSMUST00000111191] [ENSMUST00000111192] [ENSMUST00000111194] [ENSMUST00000111198]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005218
AA Change: D2G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000005218
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	251	276	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	640	653	N/A	INTRINSIC
low complexity region	689	703	N/A	INTRINSIC
PDB:2ZPY\|B	710	729	1e-6	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060516
AA Change: D2G

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000062330
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	229	239	N/A	INTRINSIC
low complexity region	440	453	N/A	INTRINSIC
low complexity region	489	503	N/A	INTRINSIC
PDB:2ZPY\|B	510	529	1e-6	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083749

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099673
AA Change: D2G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097265
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	225	238	N/A	INTRINSIC
low complexity region	274	288	N/A	INTRINSIC
PDB:2ZPY\|B	295	314	1e-6	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000111190
AA Change: D2G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106821
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	324	337	N/A	INTRINSIC
low complexity region	373	387	N/A	INTRINSIC
PDB:2ZPY\|B	394	413	8e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111191
AA Change: D2G

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106822
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	358	371	N/A	INTRINSIC
low complexity region	407	421	N/A	INTRINSIC
PDB:2ZPY\|B	428	447	9e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000111192
AA Change: D2G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106823
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	294	307	N/A	INTRINSIC
low complexity region	343	357	N/A	INTRINSIC
PDB:2ZPY\|B	364	383	1e-6	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000111194
AA Change: D2G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106825
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	268	278	N/A	INTRINSIC
low complexity region	302	312	N/A	INTRINSIC
low complexity region	437	450	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC
PDB:2ZPY\|B	507	526	1e-6	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000111198
AA Change: D2G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106829
Gene: ENSMUSG00000005087
AA Change: D2G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	306	316	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	566	580	N/A	INTRINSIC
PDB:2ZPY\|B	587	606	1e-6	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124624

Meta Mutation Damage Score

0.2048

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(4) Targeted, other(3)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,831	L388P	possibly damaging	Het
4930432K21Rik	C	T	8: 84,167,485	T427I	probably damaging	Het
4932415D10Rik	T	A	10: 82,284,483	Q4231L	probably damaging	Het
Abcc1	A	G	16: 14,443,455	E699G	probably damaging	Het
Ap4e1	T	A	2: 127,064,979	V1053D	possibly damaging	Het
Apobec1	T	A	6: 122,581,497	I100F	probably damaging	Het
Atp6v1g3	G	T	1: 138,283,742	K53N	probably damaging	Het
Bag3	C	T	7: 128,546,106	R482W	probably damaging	Het
Cacna1i	A	G	15: 80,395,078	T2007A	possibly damaging	Het
Cdadc1	T	A	14: 59,589,923	I100F	possibly damaging	Het
Cdh16	A	G	8: 104,618,045	F485L	probably damaging	Het
Cdhr5	T	A	7: 141,269,197	K817*	probably null	Het
Cfap46	G	T	7: 139,678,577	P260Q	probably damaging	Het
Clec11a	C	T	7: 44,306,408	E72K	possibly damaging	Het
Cnr2	C	A	4: 135,916,765	N51K	probably damaging	Het
Col3a1	T	A	1: 45,331,712		probably benign	Het
Cxcr1	G	A	1: 74,191,828	T345M	probably damaging	Het
Cyp2s1	T	C	7: 25,816,319		probably null	Het
Dalrd3	C	T	9: 108,572,290	T474M	probably damaging	Het
Ddit4	C	T	10: 59,951,505	S3N	probably benign	Het
Ddx41	T	C	13: 55,535,895	K108E	possibly damaging	Het
Ece2	A	T	16: 20,643,727	H732L	probably benign	Het
Etv3	T	G	3: 87,536,015	L302R	possibly damaging	Het
Fam135b	A	G	15: 71,462,136	S1070P	probably damaging	Het
Fam160a2	A	T	7: 105,389,882	I50N	probably damaging	Het
Gm11567	T	A	11: 99,879,611	I125N	unknown	Het
Grm3	A	G	5: 9,570,536	L236P	probably benign	Het
Hip1	T	A	5: 135,433,085	R97*	probably null	Het
Hoxa5	T	C	6: 52,204,217	Y45C	probably damaging	Het
Ighg1	T	A	12: 113,329,034	H305L	probably damaging	Het
Inpp5b	T	A	4: 124,782,436	C362S	probably benign	Het
Kif1c	A	G	11: 70,708,447	K391E	probably benign	Het
Klf9	T	C	19: 23,141,882	V43A	probably benign	Het
Krt28	T	A	11: 99,374,494	I116F	probably damaging	Het
Lct	A	T	1: 128,295,232	D1439E	probably damaging	Het
Liph	G	A	16: 21,965,995	T284M	possibly damaging	Het
Lrrc75b	T	C	10: 75,557,221	K98R	possibly damaging	Het
Lypd4	T	C	7: 24,865,179	Q178R	probably benign	Het
Map1a	T	A	2: 121,306,043	S2209T	probably damaging	Het
Map3k21	C	T	8: 125,938,824	T584I	probably benign	Het
Map3k6	T	C	4: 133,245,544	V338A	probably damaging	Het
Mapk8ip3	A	T	17: 24,903,311	V699E	possibly damaging	Het
Marc1	A	C	1: 184,810,919	S71A	probably damaging	Het
Nckap1l	T	C	15: 103,455,025	S53P	probably benign	Het
Nt5e	T	C	9: 88,327,687	M1T	probably null	Het
Nudt22	T	C	19: 6,995,528	H64R	probably damaging	Het
Olfr1048	T	C	2: 86,235,932	N294S	probably damaging	Het
Olfr108	A	T	17: 37,445,772	T84S	probably damaging	Het
Olfr198	A	G	16: 59,202,006	L140P	probably damaging	Het
Olfr314	A	T	11: 58,786,828	Y198F	probably damaging	Het
Olfr322	T	C	11: 58,666,399	I280T	possibly damaging	Het
Olfr690	A	T	7: 105,329,565	V209D	probably damaging	Het
Otogl	T	C	10: 107,886,552	I314V	probably benign	Het
Pan2	G	T	10: 128,308,100	E106D	probably benign	Het
Papss1	T	A	3: 131,631,804	Y554*	probably null	Het
Pcnx	T	C	12: 81,895,029	V67A	possibly damaging	Het
Pdpk1	A	C	17: 24,106,855	Y122*	probably null	Het
Pkd1l1	A	T	11: 8,879,202	N1463K	probably damaging	Het
Ptgfrn	C	A	3: 101,043,362	M878I	probably damaging	Het
Ranbp3	G	A	17: 56,710,703	G453E	probably benign	Het
Rapgef2	T	C	3: 79,094,850	D261G	probably damaging	Het
Reep2	A	G	18: 34,846,218	S199G	probably benign	Het
Rnpep	G	A	1: 135,277,521	T202I	probably damaging	Het
Sass6	T	A	3: 116,607,496		probably null	Het
Sema3e	A	G	5: 14,162,243	D111G	probably damaging	Het
Slc29a4	A	G	5: 142,711,972	E60G	probably damaging	Het
Sptlc3	T	C	2: 139,546,408	Y107H	probably damaging	Het
Stx6	T	C	1: 155,198,179	I245T	probably benign	Het
Syne2	T	C	12: 75,918,532	S774P	probably damaging	Het
Tbc1d16	T	A	11: 119,158,791	Q293L	probably damaging	Het
Tbc1d30	T	C	10: 121,296,787	D224G	probably damaging	Het
Tbc1d32	T	A	10: 56,150,877	N759Y	possibly damaging	Het
Tdrd12	G	T	7: 35,511,300	A166E	probably damaging	Het
Tex14	A	G	11: 87,514,220	R653G	probably benign	Het
Them6	A	T	15: 74,721,805	R171W	probably null	Het
Tln2	T	C	9: 67,296,358	T489A	probably benign	Het
Tmem87a	A	G	2: 120,403,946	F39L	probably benign	Het
Toporsl	T	A	4: 52,611,515	C469*	probably null	Het
Tpr	T	C	1: 150,423,818	S1147P	probably damaging	Het
Trp53bp1	T	C	2: 121,236,662	M528V	probably benign	Het
Trpm6	T	A	19: 18,830,207	C1039S	probably damaging	Het
Ttc16	T	A	2: 32,775,336	S5C	probably damaging	Het
Ttn	T	C	2: 76,787,068	Y14607C	probably damaging	Het
Usp6nl	T	C	2: 6,430,464	F345L	probably damaging	Het
Vmn1r205	C	T	13: 22,592,036	G299R	probably benign	Het
Vmn2r74	G	A	7: 85,957,380	H253Y	probably benign	Het
Vps13d	A	T	4: 145,170,302	D343E	possibly damaging	Het
Vwf	A	G	6: 125,603,418	E543G		Het
Wdr92	A	G	11: 17,227,263	N207S	possibly damaging	Het
Zfat	A	T	15: 68,180,916	V343E	probably damaging	Het
Zfp316	T	C	5: 143,264,091	E139G	unknown	Het
Zfp943	T	A	17: 21,992,832	C300S	probably damaging	Het
Zkscan16	A	G	4: 58,957,748	K677E	probably benign	Het

Other mutations in Cd44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Cd44	APN	2	102855947	missense	possibly damaging	0.73
IGL01087:Cd44	APN	2	102822262	missense	probably damaging	1.00
IGL01413:Cd44	APN	2	102814287	missense	probably damaging	0.99
IGL01830:Cd44	APN	2	102842258	splice site	probably benign
IGL02221:Cd44	APN	2	102846513	missense	probably benign	0.01
IGL02271:Cd44	APN	2	102831387	missense	possibly damaging	0.93
IGL02552:Cd44	APN	2	102848731	missense	probably benign	0.01
IGL02861:Cd44	APN	2	102832481	critical splice donor site	probably null
IGL03309:Cd44	APN	2	102814177	missense	probably damaging	1.00
IGL03352:Cd44	APN	2	102845414	intron	probably benign
Jialin	UTSW	2	102865370	missense	probably damaging	0.99
Kale	UTSW	2	102824303	missense	probably damaging	0.99
N/A - 535:Cd44	UTSW	2	102814189	missense	possibly damaging	0.50
R0488:Cd44	UTSW	2	102834219	splice site	probably benign
R1441:Cd44	UTSW	2	102846418	missense	probably damaging	0.99
R1482:Cd44	UTSW	2	102831383	missense	probably damaging	1.00
R1497:Cd44	UTSW	2	102842955	splice site	probably null
R1803:Cd44	UTSW	2	102834252	missense	probably damaging	1.00
R1952:Cd44	UTSW	2	102853087	missense	probably damaging	0.98
R2093:Cd44	UTSW	2	102814284	missense	probably damaging	1.00
R2180:Cd44	UTSW	2	102828610	missense	possibly damaging	0.66
R2425:Cd44	UTSW	2	102861586	missense	probably damaging	1.00
R3687:Cd44	UTSW	2	102901350	splice site	probably null
R3820:Cd44	UTSW	2	102901393	splice site	probably null
R3821:Cd44	UTSW	2	102901393	splice site	probably null
R3822:Cd44	UTSW	2	102901393	splice site	probably null
R4060:Cd44	UTSW	2	102901342	missense	probably damaging	1.00
R4633:Cd44	UTSW	2	102853047	missense	possibly damaging	0.86
R4647:Cd44	UTSW	2	102837929	missense	possibly damaging	0.68
R4780:Cd44	UTSW	2	102861565	missense	probably damaging	1.00
R5087:Cd44	UTSW	2	102831354	missense	possibly damaging	0.83
R5118:Cd44	UTSW	2	102865370	missense	probably damaging	0.99
R5449:Cd44	UTSW	2	102832546	missense	probably damaging	1.00
R5928:Cd44	UTSW	2	102824303	missense	probably damaging	0.99
R5995:Cd44	UTSW	2	102861670	missense	probably damaging	1.00
R5999:Cd44	UTSW	2	102845397	missense	probably benign	0.42
R7050:Cd44	UTSW	2	102814137	missense	probably damaging	0.99
R7350:Cd44	UTSW	2	102834262	missense	probably benign	0.19
R7797:Cd44	UTSW	2	102848734	missense	probably benign	0.34
R7866:Cd44	UTSW	2	102842259	critical splice donor site	probably null
R8138:Cd44	UTSW	2	102832497	missense	probably benign	0.00
R8185:Cd44	UTSW	2	102824320	missense	possibly damaging	0.52
R8732:Cd44	UTSW	2	102834300	missense	possibly damaging	0.67
R8955:Cd44	UTSW	2	102853018	missense	probably damaging	0.98
R9249:Cd44	UTSW	2	102831402	missense	possibly damaging	0.51
R9548:Cd44	UTSW	2	102831487	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GCTTTGCTAGCCCAATTCAC -3'
(R):5'- TTGGCTGCTTAGTCACAGC -3'

Sequencing Primer
(F):5'- TTGCTAGCCCAATTCACTACAG -3'
(R):5'- TAGTCACAGCCCCCTCG -3'

Posted On

2016-11-08