Incidental Mutation 'R5642:Tmem87a'
ID440717
Institutional Source Beutler Lab
Gene Symbol Tmem87a
Ensembl Gene ENSMUSG00000033808
Gene Nametransmembrane protein 87A
SynonymsA930025J12Rik
MMRRC Submission 043290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R5642 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120355312-120404113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120403946 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 39 (F39L)
Ref Sequence ENSEMBL: ENSMUSP00000087500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090042] [ENSMUST00000090046] [ENSMUST00000110729] [ENSMUST00000135074]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043755
Predicted Effect probably benign
Transcript: ENSMUST00000090042
AA Change: F39L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087496
Gene: ENSMUSG00000033808
AA Change: F39L

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 471 1.1e-87 PFAM
low complexity region 480 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090046
AA Change: F39L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000087500
Gene: ENSMUSG00000033808
AA Change: F39L

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 185 472 1.5e-85 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110729
AA Change: F39L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106357
Gene: ENSMUSG00000033808
AA Change: F39L

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 472 2.4e-86 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131523
Predicted Effect probably benign
Transcript: ENSMUST00000135074
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154574
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ddx41 T C 13: 55,535,895 K108E possibly damaging Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Inpp5b T A 4: 124,782,436 C362S probably benign Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map1a T A 2: 121,306,043 S2209T probably damaging Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Slc29a4 A G 5: 142,711,972 E60G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trp53bp1 T C 2: 121,236,662 M528V probably benign Het
Trpm6 T A 19: 18,830,207 C1039S probably damaging Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Tmem87a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tmem87a APN 2 120379780 splice site probably benign
IGL00912:Tmem87a APN 2 120403936 missense possibly damaging 0.54
IGL01301:Tmem87a APN 2 120380769 missense probably benign 0.01
IGL01413:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL01418:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL02083:Tmem87a APN 2 120397380 missense probably damaging 1.00
IGL02150:Tmem87a APN 2 120360076 missense probably damaging 0.99
IGL02256:Tmem87a APN 2 120377896 missense probably damaging 1.00
IGL02314:Tmem87a APN 2 120404021 missense possibly damaging 0.57
IGL02501:Tmem87a APN 2 120404053 missense probably damaging 0.98
IGL02550:Tmem87a APN 2 120374485 splice site probably null
IGL03082:Tmem87a APN 2 120397366 missense possibly damaging 0.81
ANU18:Tmem87a UTSW 2 120380769 missense probably benign 0.01
R0254:Tmem87a UTSW 2 120375507 missense probably damaging 1.00
R0285:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R0498:Tmem87a UTSW 2 120394465 missense probably benign 0.01
R0611:Tmem87a UTSW 2 120375448 missense possibly damaging 0.46
R0632:Tmem87a UTSW 2 120359542 missense probably damaging 1.00
R0787:Tmem87a UTSW 2 120370484 missense probably benign 0.22
R1599:Tmem87a UTSW 2 120394387 missense probably damaging 1.00
R1977:Tmem87a UTSW 2 120374504 missense probably benign 0.02
R2059:Tmem87a UTSW 2 120369292 missense probably damaging 1.00
R2396:Tmem87a UTSW 2 120404059 start codon destroyed probably null 0.02
R2496:Tmem87a UTSW 2 120394378 missense probably damaging 0.96
R4478:Tmem87a UTSW 2 120369343 nonsense probably null
R4621:Tmem87a UTSW 2 120397424 missense probably benign 0.00
R4739:Tmem87a UTSW 2 120360037 critical splice donor site probably null
R5138:Tmem87a UTSW 2 120371545 missense possibly damaging 0.88
R5314:Tmem87a UTSW 2 120377926 missense probably damaging 0.99
R5391:Tmem87a UTSW 2 120362877 critical splice donor site probably null
R5536:Tmem87a UTSW 2 120397430 missense probably damaging 0.96
R5618:Tmem87a UTSW 2 120369306 missense probably benign 0.44
R5884:Tmem87a UTSW 2 120404124 unclassified probably benign
R6104:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R6158:Tmem87a UTSW 2 120360103 splice site probably null
R6195:Tmem87a UTSW 2 120392175 splice site probably null
R6233:Tmem87a UTSW 2 120392175 splice site probably null
R6261:Tmem87a UTSW 2 120404021 missense possibly damaging 0.57
R6403:Tmem87a UTSW 2 120380771 missense possibly damaging 0.94
R6405:Tmem87a UTSW 2 120379750 missense probably damaging 1.00
R6540:Tmem87a UTSW 2 120403919 missense probably benign 0.00
R6583:Tmem87a UTSW 2 120375477 missense possibly damaging 0.93
R6995:Tmem87a UTSW 2 120362928 missense possibly damaging 0.91
R7081:Tmem87a UTSW 2 120380783 missense possibly damaging 0.88
R7384:Tmem87a UTSW 2 120371523 critical splice donor site probably null
R7558:Tmem87a UTSW 2 120374510 missense probably benign 0.00
R7904:Tmem87a UTSW 2 120379717 missense probably damaging 1.00
R8124:Tmem87a UTSW 2 120392195 missense probably benign
R8165:Tmem87a UTSW 2 120370478 missense possibly damaging 0.95
R8259:Tmem87a UTSW 2 120397447 missense possibly damaging 0.65
R8315:Tmem87a UTSW 2 120403960 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACACGGACGCTCTGGGTATTC -3'
(R):5'- AGTTTCAAGGACCCGGATAATC -3'

Sequencing Primer
(F):5'- GGGTATTCCACTCACTTTGGGAAC -3'
(R):5'- CCACAAAGTAGCGCCGG -3'
Posted On2016-11-08