Incidental Mutation 'R5642:Trp53bp1'
ID440718
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission 043290-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5642 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121236662 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 528 (M528V)
Ref Sequence ENSEMBL: ENSMUSP00000114457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]
Predicted Effect probably benign
Transcript: ENSMUST00000110647
AA Change: M528V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: M528V

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110648
AA Change: M528V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: M528V

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124031
Predicted Effect probably benign
Transcript: ENSMUST00000129752
Predicted Effect probably benign
Transcript: ENSMUST00000131245
AA Change: M528V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: M528V

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142400
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ddx41 T C 13: 55,535,895 K108E possibly damaging Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Inpp5b T A 4: 124,782,436 C362S probably benign Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map1a T A 2: 121,306,043 S2209T probably damaging Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Slc29a4 A G 5: 142,711,972 E60G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Tmem87a A G 2: 120,403,946 F39L probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trpm6 T A 19: 18,830,207 C1039S probably damaging Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121247814 splice site probably null
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
R7955:Trp53bp1 UTSW 2 121235744 missense possibly damaging 0.59
R8099:Trp53bp1 UTSW 2 121199749 missense probably damaging 1.00
R8200:Trp53bp1 UTSW 2 121236176 missense probably benign 0.00
R8282:Trp53bp1 UTSW 2 121199042 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121244060 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACATCTTCAGCAACCGCGTC -3'
(R):5'- TTCCATCACCAAGTCTGGAAGAAC -3'

Sequencing Primer
(F):5'- AGCAACCGCGTCTTCTCTG -3'
(R):5'- CCAAGACTTCAGAGAGTGA -3'
Posted On2016-11-08