Incidental Mutation 'R5642:Map1a'
ID440719
Institutional Source Beutler Lab
Gene Symbol Map1a
Ensembl Gene ENSMUSG00000027254
Gene Namemicrotubule-associated protein 1 A
SynonymsMtap1, Mtap-1, 6330416M19Rik, Mtap1a
MMRRC Submission 043290-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R5642 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121289600-121310832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121306043 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2209 (S2209T)
Ref Sequence ENSEMBL: ENSMUSP00000106269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]
Predicted Effect probably benign
Transcript: ENSMUST00000052029
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094639
AA Change: S2447T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: S2447T

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110625
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110626
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110639
AA Change: S2209T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: S2209T

DomainStartEndE-ValueType
Blast:Lactamase_B 48 300 3e-54 BLAST
SCOP:d1eq1a_ 346 461 1e-4 SMART
low complexity region 505 517 N/A INTRINSIC
low complexity region 582 595 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1302 1317 N/A INTRINSIC
coiled coil region 1335 1364 N/A INTRINSIC
internal_repeat_1 1378 1488 5.43e-6 PROSPERO
coiled coil region 1509 1533 N/A INTRINSIC
internal_repeat_1 1536 1650 5.43e-6 PROSPERO
low complexity region 1822 1846 N/A INTRINSIC
low complexity region 1883 1895 N/A INTRINSIC
low complexity region 1918 1931 N/A INTRINSIC
low complexity region 2145 2158 N/A INTRINSIC
low complexity region 2198 2222 N/A INTRINSIC
low complexity region 2279 2303 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
low complexity region 2424 2444 N/A INTRINSIC
low complexity region 2447 2466 N/A INTRINSIC
low complexity region 2478 2490 N/A INTRINSIC
low complexity region 2528 2552 N/A INTRINSIC
low complexity region 2742 2750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133283
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ddx41 T C 13: 55,535,895 K108E possibly damaging Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Inpp5b T A 4: 124,782,436 C362S probably benign Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Slc29a4 A G 5: 142,711,972 E60G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Tmem87a A G 2: 120,403,946 F39L probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trp53bp1 T C 2: 121,236,662 M528V probably benign Het
Trpm6 T A 19: 18,830,207 C1039S probably damaging Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Map1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Map1a APN 2 121299027 missense probably damaging 0.99
IGL00826:Map1a APN 2 121302276 missense possibly damaging 0.87
IGL01476:Map1a APN 2 121305207 missense probably damaging 1.00
IGL02029:Map1a APN 2 121303298 missense possibly damaging 0.57
IGL02100:Map1a APN 2 121302846 missense probably damaging 0.99
IGL02136:Map1a APN 2 121300212 missense probably damaging 1.00
IGL02146:Map1a APN 2 121299446 missense probably damaging 1.00
IGL02264:Map1a APN 2 121307313 missense probably damaging 1.00
IGL02456:Map1a APN 2 121298653 missense probably damaging 1.00
IGL02485:Map1a APN 2 121299288 missense probably damaging 1.00
IGL02535:Map1a APN 2 121302177 nonsense probably null
IGL02628:Map1a APN 2 121300104 missense probably damaging 1.00
IGL02721:Map1a APN 2 121304037 missense probably benign 0.44
IGL03273:Map1a APN 2 121300238 missense probably damaging 1.00
IGL03281:Map1a APN 2 121305060 missense probably damaging 1.00
IGL02991:Map1a UTSW 2 121301610 missense probably damaging 0.99
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0218:Map1a UTSW 2 121305425 missense probably benign 0.00
R0363:Map1a UTSW 2 121302044 missense probably damaging 1.00
R0450:Map1a UTSW 2 121305774 missense probably benign 0.27
R0469:Map1a UTSW 2 121305774 missense probably benign 0.27
R0477:Map1a UTSW 2 121302101 missense probably damaging 1.00
R0504:Map1a UTSW 2 121302941 missense probably benign 0.03
R0510:Map1a UTSW 2 121305774 missense probably benign 0.27
R0521:Map1a UTSW 2 121305753 missense probably damaging 1.00
R0601:Map1a UTSW 2 121298602 missense probably damaging 1.00
R0619:Map1a UTSW 2 121305255 missense probably damaging 0.96
R0633:Map1a UTSW 2 121308014 missense probably damaging 1.00
R0652:Map1a UTSW 2 121302783 missense probably benign 0.04
R0893:Map1a UTSW 2 121300533 missense probably damaging 1.00
R0960:Map1a UTSW 2 121301643 missense probably benign 0.16
R1115:Map1a UTSW 2 121307378 splice site probably null
R1166:Map1a UTSW 2 121300260 missense probably damaging 1.00
R1326:Map1a UTSW 2 121306190 nonsense probably null
R1331:Map1a UTSW 2 121306220 nonsense probably null
R1395:Map1a UTSW 2 121303925 missense probably benign 0.26
R1489:Map1a UTSW 2 121300437 missense possibly damaging 0.91
R1573:Map1a UTSW 2 121304126 missense probably benign 0.37
R1596:Map1a UTSW 2 121289765 missense probably benign 0.00
R1662:Map1a UTSW 2 121306408 missense possibly damaging 0.90
R1675:Map1a UTSW 2 121302655 nonsense probably null
R1919:Map1a UTSW 2 121307012 missense probably damaging 1.00
R2122:Map1a UTSW 2 121299446 missense probably damaging 1.00
R2126:Map1a UTSW 2 121298641 missense probably damaging 0.96
R2143:Map1a UTSW 2 121301945 missense probably damaging 1.00
R2172:Map1a UTSW 2 121307932 missense probably damaging 1.00
R2249:Map1a UTSW 2 121300287 missense probably damaging 1.00
R2254:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R2255:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R3834:Map1a UTSW 2 121307322 missense probably damaging 1.00
R4011:Map1a UTSW 2 121300127 missense probably damaging 1.00
R4346:Map1a UTSW 2 121301325 missense probably benign 0.13
R4842:Map1a UTSW 2 121302086 missense probably damaging 1.00
R4933:Map1a UTSW 2 121305905 missense probably damaging 1.00
R4978:Map1a UTSW 2 121301142 missense probably benign 0.00
R4988:Map1a UTSW 2 121303050 missense probably benign 0.34
R5026:Map1a UTSW 2 121307538 missense possibly damaging 0.83
R5086:Map1a UTSW 2 121304504 missense probably damaging 1.00
R5155:Map1a UTSW 2 121302386 missense probably damaging 1.00
R5232:Map1a UTSW 2 121301985 missense probably damaging 1.00
R5311:Map1a UTSW 2 121302387 missense probably damaging 1.00
R5401:Map1a UTSW 2 121299672 missense probably damaging 1.00
R5465:Map1a UTSW 2 121306025 missense probably damaging 1.00
R5526:Map1a UTSW 2 121305662 missense probably damaging 1.00
R5726:Map1a UTSW 2 121305065 missense probably damaging 1.00
R5817:Map1a UTSW 2 121298910 missense possibly damaging 0.81
R5855:Map1a UTSW 2 121303674 missense possibly damaging 0.74
R5917:Map1a UTSW 2 121305216 missense probably damaging 1.00
R5974:Map1a UTSW 2 121304376 missense probably benign 0.20
R5987:Map1a UTSW 2 121304295 missense possibly damaging 0.56
R6151:Map1a UTSW 2 121289823 missense probably benign 0.12
R6406:Map1a UTSW 2 121300743 missense probably damaging 1.00
R7014:Map1a UTSW 2 121300239 missense probably damaging 1.00
R7099:Map1a UTSW 2 121300517 missense probably benign 0.04
R7211:Map1a UTSW 2 121304643 missense probably benign 0.02
R7230:Map1a UTSW 2 121300818 missense probably damaging 1.00
R7305:Map1a UTSW 2 121299458 missense probably damaging 1.00
R7382:Map1a UTSW 2 121290785 missense probably damaging 1.00
R7524:Map1a UTSW 2 121289812 missense probably damaging 1.00
R7699:Map1a UTSW 2 121299720 missense probably damaging 1.00
R7767:Map1a UTSW 2 121302036 missense probably damaging 1.00
R7883:Map1a UTSW 2 121305372 missense probably damaging 1.00
R7896:Map1a UTSW 2 121305176 missense probably benign 0.00
R7993:Map1a UTSW 2 121304576 missense possibly damaging 0.84
R8270:Map1a UTSW 2 121299020 missense probably damaging 0.99
R8365:Map1a UTSW 2 121308047 missense probably damaging 1.00
R8428:Map1a UTSW 2 121304937 missense probably benign 0.42
RF003:Map1a UTSW 2 121306296 small insertion probably benign
RF007:Map1a UTSW 2 121306308 small insertion probably benign
RF009:Map1a UTSW 2 121306301 small insertion probably benign
RF010:Map1a UTSW 2 121306318 small insertion probably benign
RF014:Map1a UTSW 2 121306295 small insertion probably benign
RF017:Map1a UTSW 2 121306308 small insertion probably benign
RF024:Map1a UTSW 2 121306307 small insertion probably benign
RF025:Map1a UTSW 2 121306294 small insertion probably benign
RF030:Map1a UTSW 2 121306311 small insertion probably benign
RF030:Map1a UTSW 2 121306317 small insertion probably benign
RF033:Map1a UTSW 2 121306299 small insertion probably benign
RF034:Map1a UTSW 2 121306304 small insertion probably benign
RF034:Map1a UTSW 2 121306307 small insertion probably benign
RF035:Map1a UTSW 2 121306301 small insertion probably benign
RF037:Map1a UTSW 2 121306294 small insertion probably benign
RF039:Map1a UTSW 2 121306304 small insertion probably benign
RF042:Map1a UTSW 2 121306287 small insertion probably benign
RF044:Map1a UTSW 2 121306293 small insertion probably benign
RF045:Map1a UTSW 2 121306293 small insertion probably benign
RF051:Map1a UTSW 2 121306296 small insertion probably benign
RF052:Map1a UTSW 2 121306295 small insertion probably benign
RF053:Map1a UTSW 2 121306290 small insertion probably benign
RF060:Map1a UTSW 2 121306318 small insertion probably benign
RF061:Map1a UTSW 2 121306287 small insertion probably benign
Z1176:Map1a UTSW 2 121303238 missense possibly damaging 0.95
Z1177:Map1a UTSW 2 121305279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGTCCGACCAAGTTTG -3'
(R):5'- GGCCCAATTCTCCTGAACTC -3'

Sequencing Primer
(F):5'- AAGTTTGGACTTCCCTGCTTCAG -3'
(R):5'- GAACTCTGTTCAGCCACCTCTAGAC -3'
Posted On2016-11-08