Incidental Mutation 'R5642:Ptgfrn'
ID 440725
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms 4833445A08Rik, CD9P-1
MMRRC Submission 043290-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5642 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 100947548-101017594 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100950678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 878 (M878I)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect probably damaging
Transcript: ENSMUST00000102694
AA Change: M878I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: M878I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,261,319 (GRCm39) E699G probably damaging Het
Ap4e1 T A 2: 126,906,899 (GRCm39) V1053D possibly damaging Het
Apobec1 T A 6: 122,558,456 (GRCm39) I100F probably damaging Het
Atp6v1g3 G T 1: 138,211,480 (GRCm39) K53N probably damaging Het
Bag3 C T 7: 128,147,830 (GRCm39) R482W probably damaging Het
Brme1 C T 8: 84,894,114 (GRCm39) T427I probably damaging Het
Cacna1i A G 15: 80,279,279 (GRCm39) T2007A possibly damaging Het
Cd44 T C 2: 102,731,687 (GRCm39) D2G probably damaging Het
Cdadc1 T A 14: 59,827,372 (GRCm39) I100F possibly damaging Het
Cdh16 A G 8: 105,344,677 (GRCm39) F485L probably damaging Het
Cdhr5 T A 7: 140,849,110 (GRCm39) K817* probably null Het
Cfap46 G T 7: 139,258,493 (GRCm39) P260Q probably damaging Het
Clec11a C T 7: 43,955,832 (GRCm39) E72K possibly damaging Het
Cnr2 C A 4: 135,644,076 (GRCm39) N51K probably damaging Het
Col3a1 T A 1: 45,370,872 (GRCm39) probably benign Het
Cxcr1 G A 1: 74,230,987 (GRCm39) T345M probably damaging Het
Cyp2s1 T C 7: 25,515,744 (GRCm39) probably null Het
Dalrd3 C T 9: 108,449,489 (GRCm39) T474M probably damaging Het
Ddit4 C T 10: 59,787,327 (GRCm39) S3N probably benign Het
Ddx41 T C 13: 55,683,708 (GRCm39) K108E possibly damaging Het
Dnaaf10 A G 11: 17,177,263 (GRCm39) N207S possibly damaging Het
Ece2 A T 16: 20,462,477 (GRCm39) H732L probably benign Het
Etv3 T G 3: 87,443,322 (GRCm39) L302R possibly damaging Het
Fam135b A G 15: 71,333,985 (GRCm39) S1070P probably damaging Het
Fhip1b A T 7: 105,039,089 (GRCm39) I50N probably damaging Het
Gm11567 T A 11: 99,770,437 (GRCm39) I125N unknown Het
Grm3 A G 5: 9,620,536 (GRCm39) L236P probably benign Het
Hip1 T A 5: 135,461,939 (GRCm39) R97* probably null Het
Hoxa5 T C 6: 52,181,197 (GRCm39) Y45C probably damaging Het
Ighg1 T A 12: 113,292,654 (GRCm39) H305L probably damaging Het
Inpp5b T A 4: 124,676,229 (GRCm39) C362S probably benign Het
Kif1c A G 11: 70,599,273 (GRCm39) K391E probably benign Het
Klf9 T C 19: 23,119,246 (GRCm39) V43A probably benign Het
Krt28 T A 11: 99,265,320 (GRCm39) I116F probably damaging Het
Lct A T 1: 128,222,969 (GRCm39) D1439E probably damaging Het
Liph G A 16: 21,784,745 (GRCm39) T284M possibly damaging Het
Lrrc75b T C 10: 75,393,055 (GRCm39) K98R possibly damaging Het
Lypd4 T C 7: 24,564,604 (GRCm39) Q178R probably benign Het
Map1a T A 2: 121,136,524 (GRCm39) S2209T probably damaging Het
Map3k21 C T 8: 126,665,563 (GRCm39) T584I probably benign Het
Map3k6 T C 4: 132,972,855 (GRCm39) V338A probably damaging Het
Mapk8ip3 A T 17: 25,122,285 (GRCm39) V699E possibly damaging Het
Mtarc1 A C 1: 184,543,116 (GRCm39) S71A probably damaging Het
Nckap1l T C 15: 103,363,452 (GRCm39) S53P probably benign Het
Nt5e T C 9: 88,209,740 (GRCm39) M1T probably null Het
Nudt22 T C 19: 6,972,896 (GRCm39) H64R probably damaging Het
Or1o11 A T 17: 37,756,663 (GRCm39) T84S probably damaging Het
Or2t44 A T 11: 58,677,654 (GRCm39) Y198F probably damaging Het
Or2w3 T C 11: 58,557,225 (GRCm39) I280T possibly damaging Het
Or52b1 A T 7: 104,978,772 (GRCm39) V209D probably damaging Het
Or5ac16 A G 16: 59,022,369 (GRCm39) L140P probably damaging Het
Or8k17 T C 2: 86,066,276 (GRCm39) N294S probably damaging Het
Otogl T C 10: 107,722,413 (GRCm39) I314V probably benign Het
Pan2 G T 10: 128,143,969 (GRCm39) E106D probably benign Het
Papss1 T A 3: 131,337,565 (GRCm39) Y554* probably null Het
Pcnx1 T C 12: 81,941,803 (GRCm39) V67A possibly damaging Het
Pdpk1 A C 17: 24,325,829 (GRCm39) Y122* probably null Het
Pkd1l1 A T 11: 8,829,202 (GRCm39) N1463K probably damaging Het
Ranbp3 G A 17: 57,017,703 (GRCm39) G453E probably benign Het
Rapgef2 T C 3: 79,002,157 (GRCm39) D261G probably damaging Het
Reep2 A G 18: 34,979,271 (GRCm39) S199G probably benign Het
Rnpep G A 1: 135,205,259 (GRCm39) T202I probably damaging Het
Sass6 T A 3: 116,401,145 (GRCm39) probably null Het
Sema3e A G 5: 14,212,257 (GRCm39) D111G probably damaging Het
Slc29a4 A G 5: 142,697,727 (GRCm39) E60G probably damaging Het
Spata31g1 T C 4: 42,971,831 (GRCm39) L388P possibly damaging Het
Spata31h1 T A 10: 82,120,317 (GRCm39) Q4231L probably damaging Het
Sptlc3 T C 2: 139,388,328 (GRCm39) Y107H probably damaging Het
Stx6 T C 1: 155,073,925 (GRCm39) I245T probably benign Het
Syne2 T C 12: 75,965,306 (GRCm39) S774P probably damaging Het
Tbc1d16 T A 11: 119,049,617 (GRCm39) Q293L probably damaging Het
Tbc1d30 T C 10: 121,132,692 (GRCm39) D224G probably damaging Het
Tbc1d32 T A 10: 56,026,973 (GRCm39) N759Y possibly damaging Het
Tdrd12 G T 7: 35,210,725 (GRCm39) A166E probably damaging Het
Tex14 A G 11: 87,405,046 (GRCm39) R653G probably benign Het
Them6 A T 15: 74,593,654 (GRCm39) R171W probably null Het
Tln2 T C 9: 67,203,640 (GRCm39) T489A probably benign Het
Tmem87a A G 2: 120,234,427 (GRCm39) F39L probably benign Het
Toporsl T A 4: 52,611,515 (GRCm39) C469* probably null Het
Tpr T C 1: 150,299,569 (GRCm39) S1147P probably damaging Het
Trp53bp1 T C 2: 121,067,143 (GRCm39) M528V probably benign Het
Trpm6 T A 19: 18,807,571 (GRCm39) C1039S probably damaging Het
Ttc16 T A 2: 32,665,348 (GRCm39) S5C probably damaging Het
Ttn T C 2: 76,617,412 (GRCm39) Y14607C probably damaging Het
Usp6nl T C 2: 6,435,275 (GRCm39) F345L probably damaging Het
Vmn1r205 C T 13: 22,776,206 (GRCm39) G299R probably benign Het
Vmn2r74 G A 7: 85,606,588 (GRCm39) H253Y probably benign Het
Vps13d A T 4: 144,896,872 (GRCm39) D343E possibly damaging Het
Vwf A G 6: 125,580,381 (GRCm39) E543G Het
Zfat A T 15: 68,052,765 (GRCm39) V343E probably damaging Het
Zfp316 T C 5: 143,249,846 (GRCm39) E139G unknown Het
Zfp943 T A 17: 22,211,813 (GRCm39) C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 (GRCm39) K677E probably benign Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 100,980,161 (GRCm39) missense probably benign 0.01
IGL01710:Ptgfrn APN 3 100,980,404 (GRCm39) missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 100,967,952 (GRCm39) critical splice donor site probably null
IGL02740:Ptgfrn APN 3 100,980,253 (GRCm39) missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 100,968,068 (GRCm39) missense probably benign
IGL02948:Ptgfrn APN 3 100,980,135 (GRCm39) missense probably benign 0.21
R1540:Ptgfrn UTSW 3 100,967,970 (GRCm39) missense probably benign 0.41
R1563:Ptgfrn UTSW 3 100,967,967 (GRCm39) missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 100,963,758 (GRCm39) missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 100,957,438 (GRCm39) missense probably benign 0.00
R1783:Ptgfrn UTSW 3 100,963,758 (GRCm39) missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 100,963,623 (GRCm39) missense probably benign
R2113:Ptgfrn UTSW 3 100,984,625 (GRCm39) missense probably benign 0.00
R2290:Ptgfrn UTSW 3 100,984,677 (GRCm39) missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 100,950,718 (GRCm39) missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 100,952,909 (GRCm39) missense probably benign 0.13
R5600:Ptgfrn UTSW 3 100,963,566 (GRCm39) missense probably damaging 0.99
R5927:Ptgfrn UTSW 3 100,967,968 (GRCm39) missense possibly damaging 0.92
R5984:Ptgfrn UTSW 3 100,957,459 (GRCm39) missense probably damaging 0.99
R6124:Ptgfrn UTSW 3 100,980,405 (GRCm39) missense probably damaging 0.98
R6331:Ptgfrn UTSW 3 100,952,936 (GRCm39) missense possibly damaging 0.64
R6363:Ptgfrn UTSW 3 100,952,894 (GRCm39) missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 100,952,955 (GRCm39) missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 100,952,762 (GRCm39) missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 100,987,511 (GRCm39) nonsense probably null
R7313:Ptgfrn UTSW 3 100,980,363 (GRCm39) missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 100,984,760 (GRCm39) missense probably benign 0.03
R7806:Ptgfrn UTSW 3 100,984,448 (GRCm39) missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 100,950,725 (GRCm39) missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 100,968,126 (GRCm39) missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 100,980,257 (GRCm39) missense probably benign 0.09
R8093:Ptgfrn UTSW 3 100,963,753 (GRCm39) missense probably benign 0.19
R8490:Ptgfrn UTSW 3 100,963,686 (GRCm39) missense probably damaging 0.99
R8856:Ptgfrn UTSW 3 100,963,927 (GRCm39) missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 100,963,753 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTCCTCGCTCAGAACTTGAC -3'
(R):5'- ACTAAGGAGTGAGCCAGTGC -3'

Sequencing Primer
(F):5'- TCGCTCAGAACTTGACATGCAG -3'
(R):5'- AGTGCTCTCTACCCTCCAG -3'
Posted On 2016-11-08