Mutagenetix > Incidental Mutations

Incidental Mutation 'R5642:Vps13d'

440736

Institutional Source

Beutler Lab

Gene Symbol

Vps13d

Ensembl Gene

ENSMUSG00000020220

Gene Name

vacuolar protein sorting 13D

Synonyms

MMRRC Submission

043290-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5642 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

144972622-145195005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 145170302 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 343 (D343E)

Ref Sequence

ENSEMBL: ENSMUSP00000020441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020441
AA Change: D343E

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: D343E

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	2	118	1.8e-37	PFAM
low complexity region	407	423	N/A	INTRINSIC
low complexity region	534	555	N/A	INTRINSIC
coiled coil region	665	685	N/A	INTRINSIC
low complexity region	765	781	N/A	INTRINSIC
low complexity region	1316	1329	N/A	INTRINSIC
low complexity region	1590	1603	N/A	INTRINSIC
Blast:IL1	1605	1726	2e-6	BLAST
low complexity region	1868	1883	N/A	INTRINSIC
low complexity region	2128	2141	N/A	INTRINSIC
UBA	2632	2669	3.73e-5	SMART
low complexity region	2674	2684	N/A	INTRINSIC
low complexity region	2707	2718	N/A	INTRINSIC
low complexity region	2866	2884	N/A	INTRINSIC
low complexity region	2973	2983	N/A	INTRINSIC
Pfam:DUF1162	3246	3530	1.1e-110	PFAM
low complexity region	3797	3810	N/A	INTRINSIC
low complexity region	3913	3921	N/A	INTRINSIC
low complexity region	4119	4132	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036579
AA Change: D349E

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: D349E

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	2	116	3.5e-35	PFAM
Pfam:VPS13	131	353	9.6e-57	PFAM
low complexity region	407	423	N/A	INTRINSIC
low complexity region	534	555	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	608	896	4.3e-35	PFAM
low complexity region	1316	1329	N/A	INTRINSIC
low complexity region	1590	1603	N/A	INTRINSIC
Blast:IL1	1605	1726	2e-6	BLAST
low complexity region	1868	1883	N/A	INTRINSIC
low complexity region	2128	2141	N/A	INTRINSIC
UBA	2632	2669	3.73e-5	SMART
low complexity region	2674	2684	N/A	INTRINSIC
low complexity region	2707	2718	N/A	INTRINSIC
low complexity region	2891	2909	N/A	INTRINSIC
low complexity region	2998	3008	N/A	INTRINSIC
Pfam:SHR-BD	3271	3555	4.2e-86	PFAM
low complexity region	3822	3835	N/A	INTRINSIC
low complexity region	3938	3946	N/A	INTRINSIC
Pfam:VPS13_C	3978	4126	4.8e-24	PFAM
low complexity region	4144	4157	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,831	L388P	possibly damaging	Het
4930432K21Rik	C	T	8: 84,167,485	T427I	probably damaging	Het
4932415D10Rik	T	A	10: 82,284,483	Q4231L	probably damaging	Het
Abcc1	A	G	16: 14,443,455	E699G	probably damaging	Het
Ap4e1	T	A	2: 127,064,979	V1053D	possibly damaging	Het
Apobec1	T	A	6: 122,581,497	I100F	probably damaging	Het
Atp6v1g3	G	T	1: 138,283,742	K53N	probably damaging	Het
Bag3	C	T	7: 128,546,106	R482W	probably damaging	Het
Cacna1i	A	G	15: 80,395,078	T2007A	possibly damaging	Het
Cd44	T	C	2: 102,901,342	D2G	probably damaging	Het
Cdadc1	T	A	14: 59,589,923	I100F	possibly damaging	Het
Cdh16	A	G	8: 104,618,045	F485L	probably damaging	Het
Cdhr5	T	A	7: 141,269,197	K817*	probably null	Het
Cfap46	G	T	7: 139,678,577	P260Q	probably damaging	Het
Clec11a	C	T	7: 44,306,408	E72K	possibly damaging	Het
Cnr2	C	A	4: 135,916,765	N51K	probably damaging	Het
Col3a1	T	A	1: 45,331,712		probably benign	Het
Cxcr1	G	A	1: 74,191,828	T345M	probably damaging	Het
Cyp2s1	T	C	7: 25,816,319		probably null	Het
Dalrd3	C	T	9: 108,572,290	T474M	probably damaging	Het
Ddit4	C	T	10: 59,951,505	S3N	probably benign	Het
Ddx41	T	C	13: 55,535,895	K108E	possibly damaging	Het
Ece2	A	T	16: 20,643,727	H732L	probably benign	Het
Etv3	T	G	3: 87,536,015	L302R	possibly damaging	Het
Fam135b	A	G	15: 71,462,136	S1070P	probably damaging	Het
Fam160a2	A	T	7: 105,389,882	I50N	probably damaging	Het
Gm11567	T	A	11: 99,879,611	I125N	unknown	Het
Grm3	A	G	5: 9,570,536	L236P	probably benign	Het
Hip1	T	A	5: 135,433,085	R97*	probably null	Het
Hoxa5	T	C	6: 52,204,217	Y45C	probably damaging	Het
Ighg1	T	A	12: 113,329,034	H305L	probably damaging	Het
Inpp5b	T	A	4: 124,782,436	C362S	probably benign	Het
Kif1c	A	G	11: 70,708,447	K391E	probably benign	Het
Klf9	T	C	19: 23,141,882	V43A	probably benign	Het
Krt28	T	A	11: 99,374,494	I116F	probably damaging	Het
Lct	A	T	1: 128,295,232	D1439E	probably damaging	Het
Liph	G	A	16: 21,965,995	T284M	possibly damaging	Het
Lrrc75b	T	C	10: 75,557,221	K98R	possibly damaging	Het
Lypd4	T	C	7: 24,865,179	Q178R	probably benign	Het
Map1a	T	A	2: 121,306,043	S2209T	probably damaging	Het
Map3k21	C	T	8: 125,938,824	T584I	probably benign	Het
Map3k6	T	C	4: 133,245,544	V338A	probably damaging	Het
Mapk8ip3	A	T	17: 24,903,311	V699E	possibly damaging	Het
Marc1	A	C	1: 184,810,919	S71A	probably damaging	Het
Nckap1l	T	C	15: 103,455,025	S53P	probably benign	Het
Nt5e	T	C	9: 88,327,687	M1T	probably null	Het
Nudt22	T	C	19: 6,995,528	H64R	probably damaging	Het
Olfr1048	T	C	2: 86,235,932	N294S	probably damaging	Het
Olfr108	A	T	17: 37,445,772	T84S	probably damaging	Het
Olfr198	A	G	16: 59,202,006	L140P	probably damaging	Het
Olfr314	A	T	11: 58,786,828	Y198F	probably damaging	Het
Olfr322	T	C	11: 58,666,399	I280T	possibly damaging	Het
Olfr690	A	T	7: 105,329,565	V209D	probably damaging	Het
Otogl	T	C	10: 107,886,552	I314V	probably benign	Het
Pan2	G	T	10: 128,308,100	E106D	probably benign	Het
Papss1	T	A	3: 131,631,804	Y554*	probably null	Het
Pcnx	T	C	12: 81,895,029	V67A	possibly damaging	Het
Pdpk1	A	C	17: 24,106,855	Y122*	probably null	Het
Pkd1l1	A	T	11: 8,879,202	N1463K	probably damaging	Het
Ptgfrn	C	A	3: 101,043,362	M878I	probably damaging	Het
Ranbp3	G	A	17: 56,710,703	G453E	probably benign	Het
Rapgef2	T	C	3: 79,094,850	D261G	probably damaging	Het
Reep2	A	G	18: 34,846,218	S199G	probably benign	Het
Rnpep	G	A	1: 135,277,521	T202I	probably damaging	Het
Sass6	T	A	3: 116,607,496		probably null	Het
Sema3e	A	G	5: 14,162,243	D111G	probably damaging	Het
Slc29a4	A	G	5: 142,711,972	E60G	probably damaging	Het
Sptlc3	T	C	2: 139,546,408	Y107H	probably damaging	Het
Stx6	T	C	1: 155,198,179	I245T	probably benign	Het
Syne2	T	C	12: 75,918,532	S774P	probably damaging	Het
Tbc1d16	T	A	11: 119,158,791	Q293L	probably damaging	Het
Tbc1d30	T	C	10: 121,296,787	D224G	probably damaging	Het
Tbc1d32	T	A	10: 56,150,877	N759Y	possibly damaging	Het
Tdrd12	G	T	7: 35,511,300	A166E	probably damaging	Het
Tex14	A	G	11: 87,514,220	R653G	probably benign	Het
Them6	A	T	15: 74,721,805	R171W	probably null	Het
Tln2	T	C	9: 67,296,358	T489A	probably benign	Het
Tmem87a	A	G	2: 120,403,946	F39L	probably benign	Het
Toporsl	T	A	4: 52,611,515	C469*	probably null	Het
Tpr	T	C	1: 150,423,818	S1147P	probably damaging	Het
Trp53bp1	T	C	2: 121,236,662	M528V	probably benign	Het
Trpm6	T	A	19: 18,830,207	C1039S	probably damaging	Het
Ttc16	T	A	2: 32,775,336	S5C	probably damaging	Het
Ttn	T	C	2: 76,787,068	Y14607C	probably damaging	Het
Usp6nl	T	C	2: 6,430,464	F345L	probably damaging	Het
Vmn1r205	C	T	13: 22,592,036	G299R	probably benign	Het
Vmn2r74	G	A	7: 85,957,380	H253Y	probably benign	Het
Vwf	A	G	6: 125,603,418	E543G		Het
Wdr92	A	G	11: 17,227,263	N207S	possibly damaging	Het
Zfat	A	T	15: 68,180,916	V343E	probably damaging	Het
Zfp316	T	C	5: 143,264,091	E139G	unknown	Het
Zfp943	T	A	17: 21,992,832	C300S	probably damaging	Het
Zkscan16	A	G	4: 58,957,748	K677E	probably benign	Het

Other mutations in Vps13d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Vps13d	APN	4	145168540	missense	probably damaging	0.98
IGL00484:Vps13d	APN	4	145126575	missense	probably benign	0.04
IGL00591:Vps13d	APN	4	145190559	missense	possibly damaging	0.95
IGL00816:Vps13d	APN	4	145155994	missense	probably benign	0.00
IGL00835:Vps13d	APN	4	145160652	missense	probably damaging	0.97
IGL00847:Vps13d	APN	4	145085408	missense	probably benign	0.26
IGL01084:Vps13d	APN	4	145154955	missense	probably benign	0.00
IGL01116:Vps13d	APN	4	144972750	unclassified	probably benign
IGL01150:Vps13d	APN	4	145149275	missense	probably benign
IGL01329:Vps13d	APN	4	145156206	missense	possibly damaging	0.69
IGL01338:Vps13d	APN	4	145088322	missense	probably damaging	1.00
IGL01583:Vps13d	APN	4	145045088	missense	probably damaging	1.00
IGL01598:Vps13d	APN	4	145016901	missense	probably benign	0.21
IGL01620:Vps13d	APN	4	145094867	missense	possibly damaging	0.70
IGL01636:Vps13d	APN	4	145075048	missense	probably damaging	1.00
IGL01723:Vps13d	APN	4	145173145	missense	possibly damaging	0.84
IGL01895:Vps13d	APN	4	145156266	missense	possibly damaging	0.57
IGL01981:Vps13d	APN	4	145086747	missense	probably damaging	0.99
IGL02192:Vps13d	APN	4	145148858	missense	probably benign	0.02
IGL02197:Vps13d	APN	4	145128309	missense	probably benign	0.01
IGL02209:Vps13d	APN	4	145156101	missense	probably damaging	0.97
IGL02219:Vps13d	APN	4	145168146	missense	probably benign	0.00
IGL02377:Vps13d	APN	4	145156364	missense	probably damaging	1.00
IGL02404:Vps13d	APN	4	145148735	missense	probably damaging	1.00
IGL02552:Vps13d	APN	4	145173137	missense	possibly damaging	0.46
IGL02651:Vps13d	APN	4	145164559	missense	probably benign	0.02
IGL02708:Vps13d	APN	4	145128280	missense	probably benign	0.12
IGL02811:Vps13d	APN	4	145131765	missense	possibly damaging	0.55
IGL02821:Vps13d	APN	4	145148762	missense	probably damaging	0.98
IGL02838:Vps13d	APN	4	145075025	missense	probably benign	0.31
IGL02968:Vps13d	APN	4	145122498	missense	probably benign	0.32
IGL03176:Vps13d	APN	4	145074963	missense	probably benign	0.16
IGL03352:Vps13d	APN	4	145167502	missense	possibly damaging	0.49
IGL03374:Vps13d	APN	4	145108575	missense	possibly damaging	0.70
IGL03375:Vps13d	APN	4	145091947	missense	probably damaging	1.00
IGL03383:Vps13d	APN	4	145168319	critical splice acceptor site	probably null
IGL03411:Vps13d	APN	4	145149324	missense	probably damaging	1.00
BB008:Vps13d	UTSW	4	145096284	nonsense	probably null
BB018:Vps13d	UTSW	4	145096284	nonsense	probably null
PIT4283001:Vps13d	UTSW	4	145108588	missense
PIT4434001:Vps13d	UTSW	4	145155247	missense
R0069:Vps13d	UTSW	4	145062563	missense	probably benign	0.09
R0069:Vps13d	UTSW	4	145062563	missense	probably benign	0.09
R0076:Vps13d	UTSW	4	145164694	splice site	probably benign
R0211:Vps13d	UTSW	4	145114778	missense	probably benign	0.08
R0219:Vps13d	UTSW	4	145105909	missense	probably benign	0.01
R0284:Vps13d	UTSW	4	145144802	missense	probably benign	0.01
R0345:Vps13d	UTSW	4	145117625	missense	possibly damaging	0.81
R0400:Vps13d	UTSW	4	145065827	missense	probably benign	0.00
R0417:Vps13d	UTSW	4	144976560	missense	probably benign	0.19
R0538:Vps13d	UTSW	4	145045095	missense	probably damaging	1.00
R0560:Vps13d	UTSW	4	145054190	missense	probably damaging	1.00
R0627:Vps13d	UTSW	4	145087184	missense	probably damaging	1.00
R0707:Vps13d	UTSW	4	145155932	missense	probably damaging	1.00
R0782:Vps13d	UTSW	4	145126625	splice site	probably benign
R0925:Vps13d	UTSW	4	145156551	missense	probably damaging	1.00
R0993:Vps13d	UTSW	4	145117692	nonsense	probably null
R1135:Vps13d	UTSW	4	145155589	missense	probably benign	0.01
R1165:Vps13d	UTSW	4	145126471	missense	probably benign
R1263:Vps13d	UTSW	4	145170348	missense	probably benign	0.01
R1397:Vps13d	UTSW	4	145141334	missense	probably damaging	1.00
R1398:Vps13d	UTSW	4	145099983	missense	probably null
R1521:Vps13d	UTSW	4	145105861	missense	probably benign	0.00
R1522:Vps13d	UTSW	4	145098172	splice site	probably null
R1725:Vps13d	UTSW	4	145143260	missense	possibly damaging	0.90
R1759:Vps13d	UTSW	4	145155857	missense	probably benign
R1826:Vps13d	UTSW	4	145155003	missense	probably damaging	0.96
R1900:Vps13d	UTSW	4	145126606	missense	probably benign	0.23
R1943:Vps13d	UTSW	4	145155857	missense	probably benign
R1955:Vps13d	UTSW	4	145156143	missense	probably damaging	1.00
R2008:Vps13d	UTSW	4	145155243	missense	probably benign	0.00
R2013:Vps13d	UTSW	4	145108508	missense	probably damaging	0.99
R2014:Vps13d	UTSW	4	145108508	missense	probably damaging	0.99
R2038:Vps13d	UTSW	4	145181115	critical splice donor site	probably null
R2108:Vps13d	UTSW	4	145075047	missense	probably damaging	0.99
R2130:Vps13d	UTSW	4	145156101	missense	probably benign	0.17
R2134:Vps13d	UTSW	4	145148339	missense	probably benign	0.00
R2168:Vps13d	UTSW	4	145087323	splice site	probably benign
R2220:Vps13d	UTSW	4	145178320	missense	probably damaging	1.00
R2240:Vps13d	UTSW	4	145110895	missense	possibly damaging	0.70
R2332:Vps13d	UTSW	4	145148686	missense	probably benign
R2357:Vps13d	UTSW	4	145074977	frame shift	probably null
R2365:Vps13d	UTSW	4	145087324	splice site	probably benign
R2571:Vps13d	UTSW	4	145149136	missense	probably benign	0.20
R3149:Vps13d	UTSW	4	145126577	missense	possibly damaging	0.70
R3150:Vps13d	UTSW	4	145086790	missense	probably damaging	0.98
R3547:Vps13d	UTSW	4	145074975	missense	probably damaging	0.99
R3716:Vps13d	UTSW	4	145075726	missense	probably damaging	1.00
R3718:Vps13d	UTSW	4	145075726	missense	probably damaging	1.00
R3725:Vps13d	UTSW	4	145115648	splice site	probably benign
R3794:Vps13d	UTSW	4	145085437	splice site	probably benign
R3875:Vps13d	UTSW	4	145190544	missense	probably damaging	1.00
R3948:Vps13d	UTSW	4	145141340	missense	probably damaging	1.00
R3953:Vps13d	UTSW	4	145148880	missense	probably damaging	1.00
R4021:Vps13d	UTSW	4	145075061	missense	possibly damaging	0.90
R4323:Vps13d	UTSW	4	145152778	missense	probably benign	0.28
R4346:Vps13d	UTSW	4	145072529	intron	probably benign
R4509:Vps13d	UTSW	4	145062602	missense	probably damaging	1.00
R4613:Vps13d	UTSW	4	145131655	missense	possibly damaging	0.95
R4657:Vps13d	UTSW	4	145074842	missense	probably damaging	1.00
R4680:Vps13d	UTSW	4	145108510	missense	possibly damaging	0.94
R4688:Vps13d	UTSW	4	145178212	missense	probably benign
R4797:Vps13d	UTSW	4	145054155	missense	probably damaging	1.00
R4798:Vps13d	UTSW	4	145178056	missense	probably damaging	0.98
R4817:Vps13d	UTSW	4	145069165	missense	probably damaging	1.00
R4839:Vps13d	UTSW	4	145085430	missense	possibly damaging	0.95
R4860:Vps13d	UTSW	4	145087161	missense	probably benign
R4860:Vps13d	UTSW	4	145087161	missense	probably benign
R4869:Vps13d	UTSW	4	145128042	missense	probably damaging	1.00
R4904:Vps13d	UTSW	4	145155445	missense	probably damaging	1.00
R4912:Vps13d	UTSW	4	145155857	missense	probably benign
R4916:Vps13d	UTSW	4	144983393	missense	probably damaging	1.00
R4976:Vps13d	UTSW	4	145105898	missense	possibly damaging	0.82
R5029:Vps13d	UTSW	4	145156282	missense	probably benign	0.02
R5049:Vps13d	UTSW	4	145086766	missense	probably damaging	1.00
R5077:Vps13d	UTSW	4	145088241	missense	probably damaging	0.98
R5119:Vps13d	UTSW	4	145105898	missense	possibly damaging	0.82
R5227:Vps13d	UTSW	4	145181207	splice site	probably null
R5291:Vps13d	UTSW	4	145062569	missense	probably damaging	0.99
R5344:Vps13d	UTSW	4	145178334	missense	probably damaging	0.98
R5348:Vps13d	UTSW	4	145065889	missense	probably damaging	0.99
R5478:Vps13d	UTSW	4	145167550	missense	probably damaging	0.99
R5632:Vps13d	UTSW	4	145074882	missense	probably damaging	0.99
R5712:Vps13d	UTSW	4	145087173	missense	probably benign	0.07
R5747:Vps13d	UTSW	4	145168283	missense	probably benign	0.00
R5752:Vps13d	UTSW	4	145148970	missense	probably benign	0.06
R5804:Vps13d	UTSW	4	145100070	missense	probably benign	0.03
R5917:Vps13d	UTSW	4	145100010	missense	probably damaging	0.96
R5932:Vps13d	UTSW	4	145045041	missense	possibly damaging	0.71
R5940:Vps13d	UTSW	4	145074975	missense	probably benign	0.09
R5978:Vps13d	UTSW	4	145122611	missense	probably benign
R6031:Vps13d	UTSW	4	145168509	missense	probably benign	0.01
R6031:Vps13d	UTSW	4	145168509	missense	probably benign	0.01
R6143:Vps13d	UTSW	4	145148565	missense	possibly damaging	0.95
R6174:Vps13d	UTSW	4	144975193	nonsense	probably null
R6191:Vps13d	UTSW	4	145149348	missense	probably damaging	1.00
R6198:Vps13d	UTSW	4	145148990	missense	probably benign	0.28
R6374:Vps13d	UTSW	4	145122681	missense	probably damaging	1.00
R6379:Vps13d	UTSW	4	145088258	missense	probably benign
R6388:Vps13d	UTSW	4	145155574	missense	probably benign	0.06
R6418:Vps13d	UTSW	4	145092280	missense	probably damaging	0.98
R6466:Vps13d	UTSW	4	145057495	missense	possibly damaging	0.47
R6602:Vps13d	UTSW	4	145103664	intron	probably benign
R6604:Vps13d	UTSW	4	145181124	missense	probably damaging	1.00
R7051:Vps13d	UTSW	4	145163344	missense	probably benign	0.00
R7052:Vps13d	UTSW	4	145163344	missense	probably benign	0.00
R7103:Vps13d	UTSW	4	145115492	missense
R7231:Vps13d	UTSW	4	145057462	missense
R7246:Vps13d	UTSW	4	145156050	missense
R7339:Vps13d	UTSW	4	145121368	missense
R7409:Vps13d	UTSW	4	145141254	missense
R7419:Vps13d	UTSW	4	145115503	missense
R7424:Vps13d	UTSW	4	145148747	missense
R7439:Vps13d	UTSW	4	145105856	missense
R7440:Vps13d	UTSW	4	145128411	missense
R7528:Vps13d	UTSW	4	145091922	missense
R7547:Vps13d	UTSW	4	145057538	missense
R7558:Vps13d	UTSW	4	145154580	missense
R7699:Vps13d	UTSW	4	145085405	missense
R7729:Vps13d	UTSW	4	145075052	missense
R7789:Vps13d	UTSW	4	145100065	missense
R7813:Vps13d	UTSW	4	145178063	nonsense	probably null
R7834:Vps13d	UTSW	4	145108573	missense
R7840:Vps13d	UTSW	4	145103676	missense
R7880:Vps13d	UTSW	4	145181114	critical splice donor site	probably null
R7912:Vps13d	UTSW	4	145173127	missense
R7915:Vps13d	UTSW	4	145086819	missense
R7931:Vps13d	UTSW	4	145096284	nonsense	probably null
R8021:Vps13d	UTSW	4	145148675	missense
R8048:Vps13d	UTSW	4	145155567	missense
R8057:Vps13d	UTSW	4	144975183	missense
R8063:Vps13d	UTSW	4	145114757	missense
R8131:Vps13d	UTSW	4	145156137	missense
R8190:Vps13d	UTSW	4	145152751	missense
R8226:Vps13d	UTSW	4	145149290	missense
R8241:Vps13d	UTSW	4	145148477	missense
R8254:Vps13d	UTSW	4	144983312	splice site	probably benign
R8305:Vps13d	UTSW	4	145092288	missense
R8415:Vps13d	UTSW	4	145091979	missense
R8460:Vps13d	UTSW	4	145170439	intron	probably benign
R8487:Vps13d	UTSW	4	145155247	missense	probably benign	0.11
R8543:Vps13d	UTSW	4	145016783	nonsense	probably null
R8679:Vps13d	UTSW	4	145085407	missense
R8716:Vps13d	UTSW	4	145075778	missense
R8749:Vps13d	UTSW	4	145138613	missense
R8772:Vps13d	UTSW	4	145075032	missense
R8788:Vps13d	UTSW	4	145086735	missense
R8789:Vps13d	UTSW	4	145069173	missense
X0021:Vps13d	UTSW	4	145155025	missense	probably damaging	0.99
Z1176:Vps13d	UTSW	4	145107067	missense
Z1177:Vps13d	UTSW	4	145154908	missense
Z1177:Vps13d	UTSW	4	145178296	missense

Predicted Primers

PCR Primer
(F):5'- TCAGTTGTTTCTTCAACCTGTGAG -3'
(R):5'- AAGGCAAGCAGTGTTCCAGG -3'

Sequencing Primer
(F):5'- TGCAATGCCAGGACTGTG -3'
(R):5'- CCAGGTTGTCTTGGATGAAGAAC -3'

Posted On

2016-11-08