Mutagenetix > Incidental Mutation

Incidental Mutation 'R5642:Grm3'

440737

Institutional Source

Beutler Lab

Gene Symbol

Grm3

Ensembl Gene

ENSMUSG00000003974

Gene Name

glutamate receptor, metabotropic 3

Synonyms

Gprc1c, mGlu3, mGluR3, 0710001G23Rik

MMRRC Submission

043290-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5642 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9485541-9725170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9570536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 236 (L236P)

Ref Sequence

ENSEMBL: ENSMUSP00000004076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004076]

AlphaFold

Q9QYS2

Predicted Effect

probably benign
Transcript: ENSMUST00000004076
AA Change: L236P

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: L236P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	67	473	4.8e-102	PFAM
Pfam:NCD3G	505	555	2.4e-14	PFAM
Pfam:7tm_3	588	825	4.7e-62	PFAM
low complexity region	849	861	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,831	L388P	possibly damaging	Het
4930432K21Rik	C	T	8: 84,167,485	T427I	probably damaging	Het
4932415D10Rik	T	A	10: 82,284,483	Q4231L	probably damaging	Het
Abcc1	A	G	16: 14,443,455	E699G	probably damaging	Het
Ap4e1	T	A	2: 127,064,979	V1053D	possibly damaging	Het
Apobec1	T	A	6: 122,581,497	I100F	probably damaging	Het
Atp6v1g3	G	T	1: 138,283,742	K53N	probably damaging	Het
Bag3	C	T	7: 128,546,106	R482W	probably damaging	Het
Cacna1i	A	G	15: 80,395,078	T2007A	possibly damaging	Het
Cd44	T	C	2: 102,901,342	D2G	probably damaging	Het
Cdadc1	T	A	14: 59,589,923	I100F	possibly damaging	Het
Cdh16	A	G	8: 104,618,045	F485L	probably damaging	Het
Cdhr5	T	A	7: 141,269,197	K817*	probably null	Het
Cfap46	G	T	7: 139,678,577	P260Q	probably damaging	Het
Clec11a	C	T	7: 44,306,408	E72K	possibly damaging	Het
Cnr2	C	A	4: 135,916,765	N51K	probably damaging	Het
Col3a1	T	A	1: 45,331,712		probably benign	Het
Cxcr1	G	A	1: 74,191,828	T345M	probably damaging	Het
Cyp2s1	T	C	7: 25,816,319		probably null	Het
Dalrd3	C	T	9: 108,572,290	T474M	probably damaging	Het
Ddit4	C	T	10: 59,951,505	S3N	probably benign	Het
Ddx41	T	C	13: 55,535,895	K108E	possibly damaging	Het
Ece2	A	T	16: 20,643,727	H732L	probably benign	Het
Etv3	T	G	3: 87,536,015	L302R	possibly damaging	Het
Fam135b	A	G	15: 71,462,136	S1070P	probably damaging	Het
Fam160a2	A	T	7: 105,389,882	I50N	probably damaging	Het
Gm11567	T	A	11: 99,879,611	I125N	unknown	Het
Hip1	T	A	5: 135,433,085	R97*	probably null	Het
Hoxa5	T	C	6: 52,204,217	Y45C	probably damaging	Het
Ighg1	T	A	12: 113,329,034	H305L	probably damaging	Het
Inpp5b	T	A	4: 124,782,436	C362S	probably benign	Het
Kif1c	A	G	11: 70,708,447	K391E	probably benign	Het
Klf9	T	C	19: 23,141,882	V43A	probably benign	Het
Krt28	T	A	11: 99,374,494	I116F	probably damaging	Het
Lct	A	T	1: 128,295,232	D1439E	probably damaging	Het
Liph	G	A	16: 21,965,995	T284M	possibly damaging	Het
Lrrc75b	T	C	10: 75,557,221	K98R	possibly damaging	Het
Lypd4	T	C	7: 24,865,179	Q178R	probably benign	Het
Map1a	T	A	2: 121,306,043	S2209T	probably damaging	Het
Map3k21	C	T	8: 125,938,824	T584I	probably benign	Het
Map3k6	T	C	4: 133,245,544	V338A	probably damaging	Het
Mapk8ip3	A	T	17: 24,903,311	V699E	possibly damaging	Het
Marc1	A	C	1: 184,810,919	S71A	probably damaging	Het
Nckap1l	T	C	15: 103,455,025	S53P	probably benign	Het
Nt5e	T	C	9: 88,327,687	M1T	probably null	Het
Nudt22	T	C	19: 6,995,528	H64R	probably damaging	Het
Olfr1048	T	C	2: 86,235,932	N294S	probably damaging	Het
Olfr108	A	T	17: 37,445,772	T84S	probably damaging	Het
Olfr198	A	G	16: 59,202,006	L140P	probably damaging	Het
Olfr314	A	T	11: 58,786,828	Y198F	probably damaging	Het
Olfr322	T	C	11: 58,666,399	I280T	possibly damaging	Het
Olfr690	A	T	7: 105,329,565	V209D	probably damaging	Het
Otogl	T	C	10: 107,886,552	I314V	probably benign	Het
Pan2	G	T	10: 128,308,100	E106D	probably benign	Het
Papss1	T	A	3: 131,631,804	Y554*	probably null	Het
Pcnx	T	C	12: 81,895,029	V67A	possibly damaging	Het
Pdpk1	A	C	17: 24,106,855	Y122*	probably null	Het
Pkd1l1	A	T	11: 8,879,202	N1463K	probably damaging	Het
Ptgfrn	C	A	3: 101,043,362	M878I	probably damaging	Het
Ranbp3	G	A	17: 56,710,703	G453E	probably benign	Het
Rapgef2	T	C	3: 79,094,850	D261G	probably damaging	Het
Reep2	A	G	18: 34,846,218	S199G	probably benign	Het
Rnpep	G	A	1: 135,277,521	T202I	probably damaging	Het
Sass6	T	A	3: 116,607,496		probably null	Het
Sema3e	A	G	5: 14,162,243	D111G	probably damaging	Het
Slc29a4	A	G	5: 142,711,972	E60G	probably damaging	Het
Sptlc3	T	C	2: 139,546,408	Y107H	probably damaging	Het
Stx6	T	C	1: 155,198,179	I245T	probably benign	Het
Syne2	T	C	12: 75,918,532	S774P	probably damaging	Het
Tbc1d16	T	A	11: 119,158,791	Q293L	probably damaging	Het
Tbc1d30	T	C	10: 121,296,787	D224G	probably damaging	Het
Tbc1d32	T	A	10: 56,150,877	N759Y	possibly damaging	Het
Tdrd12	G	T	7: 35,511,300	A166E	probably damaging	Het
Tex14	A	G	11: 87,514,220	R653G	probably benign	Het
Them6	A	T	15: 74,721,805	R171W	probably null	Het
Tln2	T	C	9: 67,296,358	T489A	probably benign	Het
Tmem87a	A	G	2: 120,403,946	F39L	probably benign	Het
Toporsl	T	A	4: 52,611,515	C469*	probably null	Het
Tpr	T	C	1: 150,423,818	S1147P	probably damaging	Het
Trp53bp1	T	C	2: 121,236,662	M528V	probably benign	Het
Trpm6	T	A	19: 18,830,207	C1039S	probably damaging	Het
Ttc16	T	A	2: 32,775,336	S5C	probably damaging	Het
Ttn	T	C	2: 76,787,068	Y14607C	probably damaging	Het
Usp6nl	T	C	2: 6,430,464	F345L	probably damaging	Het
Vmn1r205	C	T	13: 22,592,036	G299R	probably benign	Het
Vmn2r74	G	A	7: 85,957,380	H253Y	probably benign	Het
Vps13d	A	T	4: 145,170,302	D343E	possibly damaging	Het
Vwf	A	G	6: 125,603,418	E543G		Het
Wdr92	A	G	11: 17,227,263	N207S	possibly damaging	Het
Zfat	A	T	15: 68,180,916	V343E	probably damaging	Het
Zfp316	T	C	5: 143,264,091	E139G	unknown	Het
Zfp943	T	A	17: 21,992,832	C300S	probably damaging	Het
Zkscan16	A	G	4: 58,957,748	K677E	probably benign	Het

Other mutations in Grm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Grm3	APN	5	9512290	missense	probably benign
IGL01393:Grm3	APN	5	9589856	missense	probably benign	0.00
IGL01398:Grm3	APN	5	9485762	unclassified	probably benign
IGL01825:Grm3	APN	5	9511600	missense	probably damaging	1.00
IGL01966:Grm3	APN	5	9511486	missense	probably damaging	0.98
IGL02367:Grm3	APN	5	9511660	missense	probably damaging	1.00
IGL02526:Grm3	APN	5	9589847	missense	probably damaging	1.00
IGL02972:Grm3	APN	5	9512410	missense	probably damaging	1.00
IGL03356:Grm3	APN	5	9512206	missense	possibly damaging	0.89
BB002:Grm3	UTSW	5	9589880	missense	probably benign	0.09
BB012:Grm3	UTSW	5	9589880	missense	probably benign	0.09
R0032:Grm3	UTSW	5	9511452	splice site	probably null
R0032:Grm3	UTSW	5	9511452	splice site	probably null
R0389:Grm3	UTSW	5	9504794	missense	probably damaging	1.00
R0455:Grm3	UTSW	5	9512477	missense	probably benign
R0538:Grm3	UTSW	5	9512446	missense	possibly damaging	0.95
R0553:Grm3	UTSW	5	9570048	missense	probably benign	0.16
R1124:Grm3	UTSW	5	9570297	missense	probably benign
R1163:Grm3	UTSW	5	9570738	missense	probably benign	0.34
R1440:Grm3	UTSW	5	9589958	missense	probably benign
R1635:Grm3	UTSW	5	9511520	missense	probably damaging	1.00
R1734:Grm3	UTSW	5	9589742	missense	probably benign	0.00
R1895:Grm3	UTSW	5	9512123	missense	probably damaging	1.00
R1926:Grm3	UTSW	5	9504881	missense	probably damaging	0.98
R1940:Grm3	UTSW	5	9511682	missense	probably damaging	1.00
R1946:Grm3	UTSW	5	9512123	missense	probably damaging	1.00
R2004:Grm3	UTSW	5	9589793	missense	possibly damaging	0.57
R2005:Grm3	UTSW	5	9589793	missense	possibly damaging	0.57
R2006:Grm3	UTSW	5	9589793	missense	possibly damaging	0.57
R3116:Grm3	UTSW	5	9570752	missense	probably damaging	1.00
R4083:Grm3	UTSW	5	9512054	missense	probably benign
R4537:Grm3	UTSW	5	9512083	missense	probably benign	0.02
R4855:Grm3	UTSW	5	9570047	missense	probably damaging	0.98
R5060:Grm3	UTSW	5	9570167	missense	probably damaging	0.99
R5093:Grm3	UTSW	5	9589766	missense	probably benign	0.01
R5419:Grm3	UTSW	5	9570233	missense	probably damaging	1.00
R5525:Grm3	UTSW	5	9504872	missense	probably damaging	1.00
R5804:Grm3	UTSW	5	9570155	missense	probably benign	0.33
R5915:Grm3	UTSW	5	9511927	missense	probably damaging	1.00
R5966:Grm3	UTSW	5	9511930	missense	probably damaging	0.98
R6151:Grm3	UTSW	5	9511556	missense	probably damaging	1.00
R6419:Grm3	UTSW	5	9570201	missense	probably damaging	1.00
R7267:Grm3	UTSW	5	9589581	missense	probably benign	0.00
R7555:Grm3	UTSW	5	9570000	missense	probably benign	0.00
R7657:Grm3	UTSW	5	9511452	splice site	probably null
R7925:Grm3	UTSW	5	9589880	missense	probably benign	0.09
R8032:Grm3	UTSW	5	9512272	missense	probably benign	0.11
R8227:Grm3	UTSW	5	9570242	missense	possibly damaging	0.65
R8462:Grm3	UTSW	5	9512365	missense	probably benign
R8500:Grm3	UTSW	5	9511726	missense	probably benign	0.21
R8696:Grm3	UTSW	5	9512311	missense	probably damaging	1.00
R8807:Grm3	UTSW	5	9511499	missense	probably damaging	1.00
R8828:Grm3	UTSW	5	9504725	missense	probably benign	0.00
R8876:Grm3	UTSW	5	9511580	missense	probably damaging	1.00
R8896:Grm3	UTSW	5	9512483	missense	possibly damaging	0.91
R9035:Grm3	UTSW	5	9570464	missense	probably damaging	0.99
R9779:Grm3	UTSW	5	9511656	missense	possibly damaging	0.74
X0020:Grm3	UTSW	5	9512195	missense	probably damaging	1.00
X0025:Grm3	UTSW	5	9485790	missense	probably damaging	1.00
X0026:Grm3	UTSW	5	9512238	nonsense	probably null
Z1088:Grm3	UTSW	5	9570183	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGTGAAGGAAGCATTCACGC -3'
(R):5'- CTTCCAGATCCCTCAGATAAGCTAC -3'

Sequencing Primer
(F):5'- AAGCATTCACGCGGCTG -3'
(R):5'- GATAAGCTACGCCTCCACCAGTG -3'

Posted On

2016-11-08