Incidental Mutation 'R5642:Slc29a4'
ID440740
Institutional Source Beutler Lab
Gene Symbol Slc29a4
Ensembl Gene ENSMUSG00000050822
Gene Namesolute carrier family 29 (nucleoside transporters), member 4
SynonymsmPMAT, ENT4
MMRRC Submission 043290-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5642 (G1)
Quality Score219
Status Not validated
Chromosome5
Chromosomal Location142692512-142722490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142711972 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 60 (E60G)
Ref Sequence ENSEMBL: ENSMUSP00000142674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058418] [ENSMUST00000198728]
Predicted Effect probably damaging
Transcript: ENSMUST00000058418
AA Change: E60G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059896
Gene: ENSMUSG00000050822
AA Change: E60G

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Nucleoside_tran 170 501 2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198728
AA Change: E60G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142674
Gene: ENSMUSG00000050822
AA Change: E60G

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC29A/ENT transporter protein family. The encoded membrane protein catalyzes the reuptake of monoamines into presynaptic neurons, thus determining the intensity and duration of monoamine neural signaling. It has been shown to transport several compounds, including serotonin, dopamine, and the neurotoxin 1-methyl-4-phenylpyridinium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic cation and monoamine uptake in the choroid plexus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ddx41 T C 13: 55,535,895 K108E possibly damaging Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Inpp5b T A 4: 124,782,436 C362S probably benign Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map1a T A 2: 121,306,043 S2209T probably damaging Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Tmem87a A G 2: 120,403,946 F39L probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trp53bp1 T C 2: 121,236,662 M528V probably benign Het
Trpm6 T A 19: 18,830,207 C1039S probably damaging Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Slc29a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Slc29a4 APN 5 142705530 missense probably benign 0.02
IGL01717:Slc29a4 APN 5 142718746 missense probably damaging 1.00
IGL02184:Slc29a4 APN 5 142717751 missense probably damaging 1.00
IGL02207:Slc29a4 APN 5 142718885 missense possibly damaging 0.76
IGL02210:Slc29a4 APN 5 142718779 missense probably damaging 1.00
IGL02323:Slc29a4 APN 5 142717652 missense probably damaging 0.99
IGL02381:Slc29a4 APN 5 142720099 missense probably benign 0.34
IGL03103:Slc29a4 APN 5 142712080 missense probably damaging 1.00
IGL03210:Slc29a4 APN 5 142715108 missense probably damaging 1.00
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0132:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0850:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R1777:Slc29a4 UTSW 5 142714062 missense probably damaging 0.96
R1864:Slc29a4 UTSW 5 142717754 missense probably damaging 1.00
R1870:Slc29a4 UTSW 5 142721488 makesense probably null
R1871:Slc29a4 UTSW 5 142721488 makesense probably null
R2092:Slc29a4 UTSW 5 142718855 missense probably damaging 1.00
R2196:Slc29a4 UTSW 5 142712895 missense possibly damaging 0.94
R4716:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R5002:Slc29a4 UTSW 5 142718746 missense probably damaging 1.00
R5162:Slc29a4 UTSW 5 142721452 missense possibly damaging 0.80
R5235:Slc29a4 UTSW 5 142718768 missense probably damaging 1.00
R5553:Slc29a4 UTSW 5 142720036 missense probably damaging 1.00
R5688:Slc29a4 UTSW 5 142714098 missense possibly damaging 0.68
R5930:Slc29a4 UTSW 5 142721402 missense possibly damaging 0.90
R5944:Slc29a4 UTSW 5 142718818 missense probably damaging 1.00
R6056:Slc29a4 UTSW 5 142720077 missense probably damaging 0.99
R6409:Slc29a4 UTSW 5 142712071 missense probably damaging 1.00
R6934:Slc29a4 UTSW 5 142712958 missense probably benign 0.02
R7508:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7509:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7716:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7910:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
R8408:Slc29a4 UTSW 5 142705354 critical splice acceptor site probably null
R8411:Slc29a4 UTSW 5 142720125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTAACACTGGCATGGCG -3'
(R):5'- ATCAGTTGTTCTCTCCAGGCAAC -3'

Sequencing Primer
(F):5'- CACTGGCATGGCGTCTGTG -3'
(R):5'- CGTCCCTTGGGATTCTCAGAG -3'
Posted On2016-11-08