Incidental Mutation 'R5642:Otogl'
ID 440763
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Name otogelin-like
Synonyms Gm6924
MMRRC Submission 043290-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5642 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 107596392-107747995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107722413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 314 (I314V)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
AlphaFold F7A4A7
Predicted Effect probably benign
Transcript: ENSMUST00000165341
AA Change: I314V

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: I314V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,261,319 (GRCm39) E699G probably damaging Het
Ap4e1 T A 2: 126,906,899 (GRCm39) V1053D possibly damaging Het
Apobec1 T A 6: 122,558,456 (GRCm39) I100F probably damaging Het
Atp6v1g3 G T 1: 138,211,480 (GRCm39) K53N probably damaging Het
Bag3 C T 7: 128,147,830 (GRCm39) R482W probably damaging Het
Brme1 C T 8: 84,894,114 (GRCm39) T427I probably damaging Het
Cacna1i A G 15: 80,279,279 (GRCm39) T2007A possibly damaging Het
Cd44 T C 2: 102,731,687 (GRCm39) D2G probably damaging Het
Cdadc1 T A 14: 59,827,372 (GRCm39) I100F possibly damaging Het
Cdh16 A G 8: 105,344,677 (GRCm39) F485L probably damaging Het
Cdhr5 T A 7: 140,849,110 (GRCm39) K817* probably null Het
Cfap46 G T 7: 139,258,493 (GRCm39) P260Q probably damaging Het
Clec11a C T 7: 43,955,832 (GRCm39) E72K possibly damaging Het
Cnr2 C A 4: 135,644,076 (GRCm39) N51K probably damaging Het
Col3a1 T A 1: 45,370,872 (GRCm39) probably benign Het
Cxcr1 G A 1: 74,230,987 (GRCm39) T345M probably damaging Het
Cyp2s1 T C 7: 25,515,744 (GRCm39) probably null Het
Dalrd3 C T 9: 108,449,489 (GRCm39) T474M probably damaging Het
Ddit4 C T 10: 59,787,327 (GRCm39) S3N probably benign Het
Ddx41 T C 13: 55,683,708 (GRCm39) K108E possibly damaging Het
Dnaaf10 A G 11: 17,177,263 (GRCm39) N207S possibly damaging Het
Ece2 A T 16: 20,462,477 (GRCm39) H732L probably benign Het
Etv3 T G 3: 87,443,322 (GRCm39) L302R possibly damaging Het
Fam135b A G 15: 71,333,985 (GRCm39) S1070P probably damaging Het
Fhip1b A T 7: 105,039,089 (GRCm39) I50N probably damaging Het
Gm11567 T A 11: 99,770,437 (GRCm39) I125N unknown Het
Grm3 A G 5: 9,620,536 (GRCm39) L236P probably benign Het
Hip1 T A 5: 135,461,939 (GRCm39) R97* probably null Het
Hoxa5 T C 6: 52,181,197 (GRCm39) Y45C probably damaging Het
Ighg1 T A 12: 113,292,654 (GRCm39) H305L probably damaging Het
Inpp5b T A 4: 124,676,229 (GRCm39) C362S probably benign Het
Kif1c A G 11: 70,599,273 (GRCm39) K391E probably benign Het
Klf9 T C 19: 23,119,246 (GRCm39) V43A probably benign Het
Krt28 T A 11: 99,265,320 (GRCm39) I116F probably damaging Het
Lct A T 1: 128,222,969 (GRCm39) D1439E probably damaging Het
Liph G A 16: 21,784,745 (GRCm39) T284M possibly damaging Het
Lrrc75b T C 10: 75,393,055 (GRCm39) K98R possibly damaging Het
Lypd4 T C 7: 24,564,604 (GRCm39) Q178R probably benign Het
Map1a T A 2: 121,136,524 (GRCm39) S2209T probably damaging Het
Map3k21 C T 8: 126,665,563 (GRCm39) T584I probably benign Het
Map3k6 T C 4: 132,972,855 (GRCm39) V338A probably damaging Het
Mapk8ip3 A T 17: 25,122,285 (GRCm39) V699E possibly damaging Het
Mtarc1 A C 1: 184,543,116 (GRCm39) S71A probably damaging Het
Nckap1l T C 15: 103,363,452 (GRCm39) S53P probably benign Het
Nt5e T C 9: 88,209,740 (GRCm39) M1T probably null Het
Nudt22 T C 19: 6,972,896 (GRCm39) H64R probably damaging Het
Or1o11 A T 17: 37,756,663 (GRCm39) T84S probably damaging Het
Or2t44 A T 11: 58,677,654 (GRCm39) Y198F probably damaging Het
Or2w3 T C 11: 58,557,225 (GRCm39) I280T possibly damaging Het
Or52b1 A T 7: 104,978,772 (GRCm39) V209D probably damaging Het
Or5ac16 A G 16: 59,022,369 (GRCm39) L140P probably damaging Het
Or8k17 T C 2: 86,066,276 (GRCm39) N294S probably damaging Het
Pan2 G T 10: 128,143,969 (GRCm39) E106D probably benign Het
Papss1 T A 3: 131,337,565 (GRCm39) Y554* probably null Het
Pcnx1 T C 12: 81,941,803 (GRCm39) V67A possibly damaging Het
Pdpk1 A C 17: 24,325,829 (GRCm39) Y122* probably null Het
Pkd1l1 A T 11: 8,829,202 (GRCm39) N1463K probably damaging Het
Ptgfrn C A 3: 100,950,678 (GRCm39) M878I probably damaging Het
Ranbp3 G A 17: 57,017,703 (GRCm39) G453E probably benign Het
Rapgef2 T C 3: 79,002,157 (GRCm39) D261G probably damaging Het
Reep2 A G 18: 34,979,271 (GRCm39) S199G probably benign Het
Rnpep G A 1: 135,205,259 (GRCm39) T202I probably damaging Het
Sass6 T A 3: 116,401,145 (GRCm39) probably null Het
Sema3e A G 5: 14,212,257 (GRCm39) D111G probably damaging Het
Slc29a4 A G 5: 142,697,727 (GRCm39) E60G probably damaging Het
Spata31g1 T C 4: 42,971,831 (GRCm39) L388P possibly damaging Het
Spata31h1 T A 10: 82,120,317 (GRCm39) Q4231L probably damaging Het
Sptlc3 T C 2: 139,388,328 (GRCm39) Y107H probably damaging Het
Stx6 T C 1: 155,073,925 (GRCm39) I245T probably benign Het
Syne2 T C 12: 75,965,306 (GRCm39) S774P probably damaging Het
Tbc1d16 T A 11: 119,049,617 (GRCm39) Q293L probably damaging Het
Tbc1d30 T C 10: 121,132,692 (GRCm39) D224G probably damaging Het
Tbc1d32 T A 10: 56,026,973 (GRCm39) N759Y possibly damaging Het
Tdrd12 G T 7: 35,210,725 (GRCm39) A166E probably damaging Het
Tex14 A G 11: 87,405,046 (GRCm39) R653G probably benign Het
Them6 A T 15: 74,593,654 (GRCm39) R171W probably null Het
Tln2 T C 9: 67,203,640 (GRCm39) T489A probably benign Het
Tmem87a A G 2: 120,234,427 (GRCm39) F39L probably benign Het
Toporsl T A 4: 52,611,515 (GRCm39) C469* probably null Het
Tpr T C 1: 150,299,569 (GRCm39) S1147P probably damaging Het
Trp53bp1 T C 2: 121,067,143 (GRCm39) M528V probably benign Het
Trpm6 T A 19: 18,807,571 (GRCm39) C1039S probably damaging Het
Ttc16 T A 2: 32,665,348 (GRCm39) S5C probably damaging Het
Ttn T C 2: 76,617,412 (GRCm39) Y14607C probably damaging Het
Usp6nl T C 2: 6,435,275 (GRCm39) F345L probably damaging Het
Vmn1r205 C T 13: 22,776,206 (GRCm39) G299R probably benign Het
Vmn2r74 G A 7: 85,606,588 (GRCm39) H253Y probably benign Het
Vps13d A T 4: 144,896,872 (GRCm39) D343E possibly damaging Het
Vwf A G 6: 125,580,381 (GRCm39) E543G Het
Zfat A T 15: 68,052,765 (GRCm39) V343E probably damaging Het
Zfp316 T C 5: 143,249,846 (GRCm39) E139G unknown Het
Zfp943 T A 17: 22,211,813 (GRCm39) C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 (GRCm39) K677E probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107,746,817 (GRCm39) missense probably benign 0.00
R0084:Otogl UTSW 10 107,737,202 (GRCm39) missense probably damaging 0.96
R0164:Otogl UTSW 10 107,710,391 (GRCm39) missense probably damaging 0.97
R0164:Otogl UTSW 10 107,710,391 (GRCm39) missense probably damaging 0.97
R0238:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0238:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0294:Otogl UTSW 10 107,613,089 (GRCm39) missense probably damaging 1.00
R0360:Otogl UTSW 10 107,606,511 (GRCm39) splice site probably benign
R0442:Otogl UTSW 10 107,712,716 (GRCm39) missense probably damaging 1.00
R0488:Otogl UTSW 10 107,639,466 (GRCm39) missense probably benign 0.02
R0507:Otogl UTSW 10 107,702,601 (GRCm39) missense possibly damaging 0.51
R0573:Otogl UTSW 10 107,616,849 (GRCm39) missense probably benign 0.00
R0581:Otogl UTSW 10 107,624,901 (GRCm39) missense possibly damaging 0.79
R0613:Otogl UTSW 10 107,652,931 (GRCm39) missense probably damaging 0.99
R0614:Otogl UTSW 10 107,634,216 (GRCm39) missense probably benign 0.14
R0742:Otogl UTSW 10 107,702,601 (GRCm39) missense possibly damaging 0.51
R0846:Otogl UTSW 10 107,608,157 (GRCm39) missense probably benign 0.40
R1146:Otogl UTSW 10 107,722,374 (GRCm39) missense probably damaging 1.00
R1146:Otogl UTSW 10 107,722,374 (GRCm39) missense probably damaging 1.00
R1439:Otogl UTSW 10 107,615,113 (GRCm39) missense probably benign 0.02
R1457:Otogl UTSW 10 107,714,013 (GRCm39) splice site probably null
R1526:Otogl UTSW 10 107,705,387 (GRCm39) missense probably damaging 1.00
R1662:Otogl UTSW 10 107,634,218 (GRCm39) missense possibly damaging 0.84
R1664:Otogl UTSW 10 107,642,437 (GRCm39) missense probably benign 0.00
R1667:Otogl UTSW 10 107,649,826 (GRCm39) nonsense probably null
R1695:Otogl UTSW 10 107,649,878 (GRCm39) missense probably damaging 0.99
R1731:Otogl UTSW 10 107,652,972 (GRCm39) missense probably damaging 1.00
R1733:Otogl UTSW 10 107,619,573 (GRCm39) missense possibly damaging 0.46
R1764:Otogl UTSW 10 107,735,322 (GRCm39) nonsense probably null
R1824:Otogl UTSW 10 107,615,692 (GRCm39) missense probably benign
R1850:Otogl UTSW 10 107,713,925 (GRCm39) missense probably damaging 1.00
R1856:Otogl UTSW 10 107,690,125 (GRCm39) missense possibly damaging 0.92
R1875:Otogl UTSW 10 107,735,451 (GRCm39) missense probably damaging 1.00
R1938:Otogl UTSW 10 107,613,436 (GRCm39) missense probably damaging 0.98
R1986:Otogl UTSW 10 107,630,051 (GRCm39) critical splice acceptor site probably null
R2072:Otogl UTSW 10 107,616,904 (GRCm39) missense probably damaging 1.00
R2117:Otogl UTSW 10 107,694,779 (GRCm39) missense probably benign 0.06
R2219:Otogl UTSW 10 107,692,838 (GRCm39) missense probably damaging 1.00
R2508:Otogl UTSW 10 107,710,361 (GRCm39) missense probably damaging 0.99
R2883:Otogl UTSW 10 107,604,842 (GRCm39) missense probably damaging 1.00
R2931:Otogl UTSW 10 107,655,865 (GRCm39) missense possibly damaging 0.85
R3620:Otogl UTSW 10 107,710,232 (GRCm39) missense probably damaging 0.99
R3621:Otogl UTSW 10 107,710,232 (GRCm39) missense probably damaging 0.99
R3735:Otogl UTSW 10 107,735,390 (GRCm39) nonsense probably null
R3812:Otogl UTSW 10 107,735,332 (GRCm39) missense probably damaging 1.00
R3880:Otogl UTSW 10 107,663,565 (GRCm39) missense probably damaging 0.96
R3958:Otogl UTSW 10 107,657,786 (GRCm39) missense probably damaging 1.00
R4063:Otogl UTSW 10 107,626,510 (GRCm39) missense probably benign 0.02
R4064:Otogl UTSW 10 107,626,510 (GRCm39) missense probably benign 0.02
R4108:Otogl UTSW 10 107,607,105 (GRCm39) missense probably benign 0.01
R4352:Otogl UTSW 10 107,705,396 (GRCm39) missense probably damaging 1.00
R4526:Otogl UTSW 10 107,722,841 (GRCm39) missense probably damaging 1.00
R4614:Otogl UTSW 10 107,727,985 (GRCm39) nonsense probably null
R4703:Otogl UTSW 10 107,657,785 (GRCm39) missense probably damaging 1.00
R4741:Otogl UTSW 10 107,615,121 (GRCm39) missense probably benign 0.00
R4790:Otogl UTSW 10 107,657,894 (GRCm39) critical splice acceptor site probably null
R4801:Otogl UTSW 10 107,737,197 (GRCm39) missense probably damaging 1.00
R4802:Otogl UTSW 10 107,737,197 (GRCm39) missense probably damaging 1.00
R4910:Otogl UTSW 10 107,715,378 (GRCm39) missense probably benign 0.05
R4913:Otogl UTSW 10 107,712,716 (GRCm39) missense probably damaging 0.98
R5238:Otogl UTSW 10 107,604,834 (GRCm39) missense probably damaging 1.00
R5261:Otogl UTSW 10 107,613,453 (GRCm39) missense probably benign 0.16
R5387:Otogl UTSW 10 107,616,794 (GRCm39) missense probably benign 0.03
R5395:Otogl UTSW 10 107,652,999 (GRCm39) missense probably benign 0.39
R5403:Otogl UTSW 10 107,644,617 (GRCm39) missense probably benign 0.08
R5482:Otogl UTSW 10 107,657,802 (GRCm39) missense probably damaging 0.99
R5547:Otogl UTSW 10 107,617,909 (GRCm39) missense possibly damaging 0.55
R5611:Otogl UTSW 10 107,622,630 (GRCm39) missense probably damaging 1.00
R5690:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5711:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5731:Otogl UTSW 10 107,717,325 (GRCm39) missense probably damaging 0.98
R5743:Otogl UTSW 10 107,692,862 (GRCm39) missense possibly damaging 0.67
R5782:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5820:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5897:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6004:Otogl UTSW 10 107,715,390 (GRCm39) missense probably damaging 1.00
R6145:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6146:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6147:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6149:Otogl UTSW 10 107,717,314 (GRCm39) missense probably benign 0.36
R6226:Otogl UTSW 10 107,607,067 (GRCm39) nonsense probably null
R6283:Otogl UTSW 10 107,626,361 (GRCm39) missense probably damaging 0.98
R6414:Otogl UTSW 10 107,617,911 (GRCm39) missense probably damaging 1.00
R6604:Otogl UTSW 10 107,657,895 (GRCm39) splice site probably null
R6634:Otogl UTSW 10 107,698,165 (GRCm39) missense probably damaging 1.00
R6727:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6755:Otogl UTSW 10 107,689,164 (GRCm39) nonsense probably null
R6795:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6797:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6864:Otogl UTSW 10 107,663,667 (GRCm39) missense probably damaging 0.96
R6924:Otogl UTSW 10 107,644,502 (GRCm39) missense probably damaging 1.00
R6967:Otogl UTSW 10 107,649,911 (GRCm39) missense probably benign 0.01
R7000:Otogl UTSW 10 107,615,692 (GRCm39) missense probably benign
R7075:Otogl UTSW 10 107,614,790 (GRCm39) missense probably benign 0.16
R7122:Otogl UTSW 10 107,702,515 (GRCm39) missense probably benign 0.08
R7176:Otogl UTSW 10 107,614,772 (GRCm39) missense probably damaging 1.00
R7184:Otogl UTSW 10 107,599,061 (GRCm39) missense probably damaging 1.00
R7199:Otogl UTSW 10 107,710,394 (GRCm39) missense possibly damaging 0.88
R7252:Otogl UTSW 10 107,657,804 (GRCm39) missense probably benign 0.06
R7286:Otogl UTSW 10 107,606,471 (GRCm39) missense probably benign 0.00
R7373:Otogl UTSW 10 107,737,112 (GRCm39) missense probably damaging 1.00
R7449:Otogl UTSW 10 107,639,524 (GRCm39) missense probably damaging 1.00
R7486:Otogl UTSW 10 107,657,849 (GRCm39) missense probably damaging 1.00
R7493:Otogl UTSW 10 107,722,843 (GRCm39) missense probably benign 0.06
R7659:Otogl UTSW 10 107,612,981 (GRCm39) missense probably benign 0.19
R7732:Otogl UTSW 10 107,642,525 (GRCm39) missense probably benign 0.01
R7754:Otogl UTSW 10 107,705,407 (GRCm39) missense probably damaging 0.99
R7757:Otogl UTSW 10 107,712,782 (GRCm39) missense probably damaging 1.00
R7800:Otogl UTSW 10 107,722,376 (GRCm39) missense probably damaging 0.99
R7864:Otogl UTSW 10 107,705,428 (GRCm39) missense probably damaging 1.00
R7879:Otogl UTSW 10 107,612,970 (GRCm39) missense probably benign 0.00
R7941:Otogl UTSW 10 107,642,663 (GRCm39) splice site probably null
R7956:Otogl UTSW 10 107,713,887 (GRCm39) missense possibly damaging 0.62
R7988:Otogl UTSW 10 107,731,637 (GRCm39) missense probably damaging 1.00
R8057:Otogl UTSW 10 107,644,476 (GRCm39) missense probably benign 0.00
R8058:Otogl UTSW 10 107,598,287 (GRCm39) missense probably damaging 1.00
R8127:Otogl UTSW 10 107,731,613 (GRCm39) missense probably damaging 1.00
R8143:Otogl UTSW 10 107,642,527 (GRCm39) missense probably damaging 1.00
R8310:Otogl UTSW 10 107,613,461 (GRCm39) missense possibly damaging 0.94
R8319:Otogl UTSW 10 107,689,127 (GRCm39) critical splice donor site probably null
R8339:Otogl UTSW 10 107,625,396 (GRCm39) missense probably damaging 0.99
R8339:Otogl UTSW 10 107,625,397 (GRCm39) missense probably benign 0.34
R8394:Otogl UTSW 10 107,722,326 (GRCm39) critical splice donor site probably null
R8428:Otogl UTSW 10 107,634,597 (GRCm39) missense probably damaging 1.00
R8444:Otogl UTSW 10 107,692,975 (GRCm39) missense probably benign 0.01
R8501:Otogl UTSW 10 107,626,421 (GRCm39) missense probably benign
R8503:Otogl UTSW 10 107,727,987 (GRCm39) missense probably damaging 1.00
R8680:Otogl UTSW 10 107,747,936 (GRCm39) critical splice donor site probably null
R9025:Otogl UTSW 10 107,613,432 (GRCm39) missense probably damaging 0.99
R9090:Otogl UTSW 10 107,652,974 (GRCm39) missense probably null 0.99
R9223:Otogl UTSW 10 107,690,205 (GRCm39) missense probably damaging 0.99
R9268:Otogl UTSW 10 107,616,917 (GRCm39) missense probably damaging 1.00
R9271:Otogl UTSW 10 107,652,974 (GRCm39) missense probably null 0.99
R9356:Otogl UTSW 10 107,617,890 (GRCm39) missense probably damaging 1.00
R9484:Otogl UTSW 10 107,737,156 (GRCm39) missense probably damaging 1.00
R9484:Otogl UTSW 10 107,657,894 (GRCm39) critical splice acceptor site probably null
R9571:Otogl UTSW 10 107,598,364 (GRCm39) missense possibly damaging 0.94
R9731:Otogl UTSW 10 107,735,328 (GRCm39) missense probably damaging 1.00
X0065:Otogl UTSW 10 107,731,643 (GRCm39) missense probably damaging 1.00
X0067:Otogl UTSW 10 107,702,538 (GRCm39) missense probably damaging 1.00
Z1176:Otogl UTSW 10 107,614,734 (GRCm39) missense probably damaging 0.97
Z1176:Otogl UTSW 10 107,613,074 (GRCm39) missense probably benign
Z1176:Otogl UTSW 10 107,624,893 (GRCm39) missense probably benign 0.00
Z1177:Otogl UTSW 10 107,689,258 (GRCm39) missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107,599,119 (GRCm39) nonsense probably null
Z1177:Otogl UTSW 10 107,712,764 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAGCTTCTCACAACTACTTGTTAG -3'
(R):5'- ACATAGCTGGGGAGCTGTTC -3'

Sequencing Primer
(F):5'- AGCACTCTTTGGCAAGCTG -3'
(R):5'- GGAGCTGTTCATTGCATTTTATAAG -3'
Posted On 2016-11-08