Mutagenetix > Incidental Mutation

Incidental Mutation 'R5642:Pkd1l1'

440767

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

MMRRC Submission

043290-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5642 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8879202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1463 (N1463K)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178195]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000154153
AA Change: N1463K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: N1463K

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178195
AA Change: N1013K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: N1013K

Domain	Start	End	E-Value	Type
Pfam:REJ	3	552	3.3e-41	PFAM
low complexity region	757	767	N/A	INTRINSIC
Blast:GPS	919	965	2e-13	BLAST
transmembrane domain	983	1000	N/A	INTRINSIC
Pfam:PLAT	1030	1145	7.2e-14	PFAM
transmembrane domain	1189	1208	N/A	INTRINSIC
transmembrane domain	1228	1250	N/A	INTRINSIC
transmembrane domain	1366	1388	N/A	INTRINSIC
transmembrane domain	1403	1425	N/A	INTRINSIC
Pfam:PKD_channel	1658	1889	2e-25	PFAM
transmembrane domain	1930	1952	N/A	INTRINSIC
low complexity region	1985	1998	N/A	INTRINSIC
low complexity region	2007	2018	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,831	L388P	possibly damaging	Het
4930432K21Rik	C	T	8: 84,167,485	T427I	probably damaging	Het
4932415D10Rik	T	A	10: 82,284,483	Q4231L	probably damaging	Het
Abcc1	A	G	16: 14,443,455	E699G	probably damaging	Het
Ap4e1	T	A	2: 127,064,979	V1053D	possibly damaging	Het
Apobec1	T	A	6: 122,581,497	I100F	probably damaging	Het
Atp6v1g3	G	T	1: 138,283,742	K53N	probably damaging	Het
Bag3	C	T	7: 128,546,106	R482W	probably damaging	Het
Cacna1i	A	G	15: 80,395,078	T2007A	possibly damaging	Het
Cd44	T	C	2: 102,901,342	D2G	probably damaging	Het
Cdadc1	T	A	14: 59,589,923	I100F	possibly damaging	Het
Cdh16	A	G	8: 104,618,045	F485L	probably damaging	Het
Cdhr5	T	A	7: 141,269,197	K817*	probably null	Het
Cfap46	G	T	7: 139,678,577	P260Q	probably damaging	Het
Clec11a	C	T	7: 44,306,408	E72K	possibly damaging	Het
Cnr2	C	A	4: 135,916,765	N51K	probably damaging	Het
Col3a1	T	A	1: 45,331,712		probably benign	Het
Cxcr1	G	A	1: 74,191,828	T345M	probably damaging	Het
Cyp2s1	T	C	7: 25,816,319		probably null	Het
Dalrd3	C	T	9: 108,572,290	T474M	probably damaging	Het
Ddit4	C	T	10: 59,951,505	S3N	probably benign	Het
Ddx41	T	C	13: 55,535,895	K108E	possibly damaging	Het
Ece2	A	T	16: 20,643,727	H732L	probably benign	Het
Etv3	T	G	3: 87,536,015	L302R	possibly damaging	Het
Fam135b	A	G	15: 71,462,136	S1070P	probably damaging	Het
Fam160a2	A	T	7: 105,389,882	I50N	probably damaging	Het
Gm11567	T	A	11: 99,879,611	I125N	unknown	Het
Grm3	A	G	5: 9,570,536	L236P	probably benign	Het
Hip1	T	A	5: 135,433,085	R97*	probably null	Het
Hoxa5	T	C	6: 52,204,217	Y45C	probably damaging	Het
Ighg1	T	A	12: 113,329,034	H305L	probably damaging	Het
Inpp5b	T	A	4: 124,782,436	C362S	probably benign	Het
Kif1c	A	G	11: 70,708,447	K391E	probably benign	Het
Klf9	T	C	19: 23,141,882	V43A	probably benign	Het
Krt28	T	A	11: 99,374,494	I116F	probably damaging	Het
Lct	A	T	1: 128,295,232	D1439E	probably damaging	Het
Liph	G	A	16: 21,965,995	T284M	possibly damaging	Het
Lrrc75b	T	C	10: 75,557,221	K98R	possibly damaging	Het
Lypd4	T	C	7: 24,865,179	Q178R	probably benign	Het
Map1a	T	A	2: 121,306,043	S2209T	probably damaging	Het
Map3k21	C	T	8: 125,938,824	T584I	probably benign	Het
Map3k6	T	C	4: 133,245,544	V338A	probably damaging	Het
Mapk8ip3	A	T	17: 24,903,311	V699E	possibly damaging	Het
Marc1	A	C	1: 184,810,919	S71A	probably damaging	Het
Nckap1l	T	C	15: 103,455,025	S53P	probably benign	Het
Nt5e	T	C	9: 88,327,687	M1T	probably null	Het
Nudt22	T	C	19: 6,995,528	H64R	probably damaging	Het
Olfr1048	T	C	2: 86,235,932	N294S	probably damaging	Het
Olfr108	A	T	17: 37,445,772	T84S	probably damaging	Het
Olfr198	A	G	16: 59,202,006	L140P	probably damaging	Het
Olfr314	A	T	11: 58,786,828	Y198F	probably damaging	Het
Olfr322	T	C	11: 58,666,399	I280T	possibly damaging	Het
Olfr690	A	T	7: 105,329,565	V209D	probably damaging	Het
Otogl	T	C	10: 107,886,552	I314V	probably benign	Het
Pan2	G	T	10: 128,308,100	E106D	probably benign	Het
Papss1	T	A	3: 131,631,804	Y554*	probably null	Het
Pcnx	T	C	12: 81,895,029	V67A	possibly damaging	Het
Pdpk1	A	C	17: 24,106,855	Y122*	probably null	Het
Ptgfrn	C	A	3: 101,043,362	M878I	probably damaging	Het
Ranbp3	G	A	17: 56,710,703	G453E	probably benign	Het
Rapgef2	T	C	3: 79,094,850	D261G	probably damaging	Het
Reep2	A	G	18: 34,846,218	S199G	probably benign	Het
Rnpep	G	A	1: 135,277,521	T202I	probably damaging	Het
Sass6	T	A	3: 116,607,496		probably null	Het
Sema3e	A	G	5: 14,162,243	D111G	probably damaging	Het
Slc29a4	A	G	5: 142,711,972	E60G	probably damaging	Het
Sptlc3	T	C	2: 139,546,408	Y107H	probably damaging	Het
Stx6	T	C	1: 155,198,179	I245T	probably benign	Het
Syne2	T	C	12: 75,918,532	S774P	probably damaging	Het
Tbc1d16	T	A	11: 119,158,791	Q293L	probably damaging	Het
Tbc1d30	T	C	10: 121,296,787	D224G	probably damaging	Het
Tbc1d32	T	A	10: 56,150,877	N759Y	possibly damaging	Het
Tdrd12	G	T	7: 35,511,300	A166E	probably damaging	Het
Tex14	A	G	11: 87,514,220	R653G	probably benign	Het
Them6	A	T	15: 74,721,805	R171W	probably null	Het
Tln2	T	C	9: 67,296,358	T489A	probably benign	Het
Tmem87a	A	G	2: 120,403,946	F39L	probably benign	Het
Toporsl	T	A	4: 52,611,515	C469*	probably null	Het
Tpr	T	C	1: 150,423,818	S1147P	probably damaging	Het
Trp53bp1	T	C	2: 121,236,662	M528V	probably benign	Het
Trpm6	T	A	19: 18,830,207	C1039S	probably damaging	Het
Ttc16	T	A	2: 32,775,336	S5C	probably damaging	Het
Ttn	T	C	2: 76,787,068	Y14607C	probably damaging	Het
Usp6nl	T	C	2: 6,430,464	F345L	probably damaging	Het
Vmn1r205	C	T	13: 22,592,036	G299R	probably benign	Het
Vmn2r74	G	A	7: 85,957,380	H253Y	probably benign	Het
Vps13d	A	T	4: 145,170,302	D343E	possibly damaging	Het
Vwf	A	G	6: 125,603,418	E543G		Het
Wdr92	A	G	11: 17,227,263	N207S	possibly damaging	Het
Zfat	A	T	15: 68,180,916	V343E	probably damaging	Het
Zfp316	T	C	5: 143,264,091	E139G	unknown	Het
Zfp943	T	A	17: 21,992,832	C300S	probably damaging	Het
Zkscan16	A	G	4: 58,957,748	K677E	probably benign	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0547:Pkd1l1	UTSW	11	8836448	splice site	probably benign
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1542:Pkd1l1	UTSW	11	8874179	missense	possibly damaging	0.82
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R3970:Pkd1l1	UTSW	11	8874218	missense	probably damaging	1.00
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R4940:Pkd1l1	UTSW	11	8844585	missense	probably benign
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5874:Pkd1l1	UTSW	11	8908688	missense	probably damaging	1.00
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7676:Pkd1l1	UTSW	11	8962708	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8849013	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
R8675:Pkd1l1	UTSW	11	8848916	critical splice donor site	probably null
R8683:Pkd1l1	UTSW	11	8871805	missense
R8709:Pkd1l1	UTSW	11	8855567	missense
R8711:Pkd1l1	UTSW	11	8865550	missense
R8725:Pkd1l1	UTSW	11	8961482	missense
R8733:Pkd1l1	UTSW	11	8933657	missense
R8822:Pkd1l1	UTSW	11	8856312	missense
R8871:Pkd1l1	UTSW	11	8950503	missense
R9009:Pkd1l1	UTSW	11	8931552	missense
R9099:Pkd1l1	UTSW	11	8972986	missense
R9119:Pkd1l1	UTSW	11	8879107	missense
R9150:Pkd1l1	UTSW	11	8836256	missense
R9314:Pkd1l1	UTSW	11	8879153	missense
R9341:Pkd1l1	UTSW	11	8836399	missense
R9341:Pkd1l1	UTSW	11	8961305	missense
R9343:Pkd1l1	UTSW	11	8836399	missense
R9343:Pkd1l1	UTSW	11	8961305	missense
R9392:Pkd1l1	UTSW	11	8844567	missense
R9424:Pkd1l1	UTSW	11	8870091	missense
R9496:Pkd1l1	UTSW	11	8833773	critical splice donor site	probably null
R9504:Pkd1l1	UTSW	11	8865631	missense
R9563:Pkd1l1	UTSW	11	8865502	missense
R9570:Pkd1l1	UTSW	11	8890697	missense
R9585:Pkd1l1	UTSW	11	8854390	missense
R9618:Pkd1l1	UTSW	11	8961420	missense
R9709:Pkd1l1	UTSW	11	8849016	missense	probably damaging	0.98
R9741:Pkd1l1	UTSW	11	8947224	missense
R9801:Pkd1l1	UTSW	11	8958964	nonsense	probably null
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- GGGGTCATCTCATTGTCAGTC -3'
(R):5'- TATGTCCATGACGACCAACAAG -3'

Sequencing Primer
(F):5'- ATTGTCAGTCATACTATCAGACCC -3'
(R):5'- TGACGACCAACAAGAGCTTG -3'

Posted On

2016-11-08