Incidental Mutation 'R5642:Syne2'
ID 440777
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Name spectrin repeat containing, nuclear envelope 2
Synonyms Nesp2g, diminished cone electroretinogram, Cpfl8, dice, 6820443O06Rik, nesprin-2, syne-2, D12Ertd777e
MMRRC Submission 043290-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R5642 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 75865092-76157702 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75965306 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 774 (S774P)
Ref Sequence ENSEMBL: ENSMUSP00000047697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000143031]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044217
AA Change: S774P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: S774P

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124685
Predicted Effect possibly damaging
Transcript: ENSMUST00000143031
AA Change: S775P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: S775P

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,261,319 (GRCm39) E699G probably damaging Het
Ap4e1 T A 2: 126,906,899 (GRCm39) V1053D possibly damaging Het
Apobec1 T A 6: 122,558,456 (GRCm39) I100F probably damaging Het
Atp6v1g3 G T 1: 138,211,480 (GRCm39) K53N probably damaging Het
Bag3 C T 7: 128,147,830 (GRCm39) R482W probably damaging Het
Brme1 C T 8: 84,894,114 (GRCm39) T427I probably damaging Het
Cacna1i A G 15: 80,279,279 (GRCm39) T2007A possibly damaging Het
Cd44 T C 2: 102,731,687 (GRCm39) D2G probably damaging Het
Cdadc1 T A 14: 59,827,372 (GRCm39) I100F possibly damaging Het
Cdh16 A G 8: 105,344,677 (GRCm39) F485L probably damaging Het
Cdhr5 T A 7: 140,849,110 (GRCm39) K817* probably null Het
Cfap46 G T 7: 139,258,493 (GRCm39) P260Q probably damaging Het
Clec11a C T 7: 43,955,832 (GRCm39) E72K possibly damaging Het
Cnr2 C A 4: 135,644,076 (GRCm39) N51K probably damaging Het
Col3a1 T A 1: 45,370,872 (GRCm39) probably benign Het
Cxcr1 G A 1: 74,230,987 (GRCm39) T345M probably damaging Het
Cyp2s1 T C 7: 25,515,744 (GRCm39) probably null Het
Dalrd3 C T 9: 108,449,489 (GRCm39) T474M probably damaging Het
Ddit4 C T 10: 59,787,327 (GRCm39) S3N probably benign Het
Ddx41 T C 13: 55,683,708 (GRCm39) K108E possibly damaging Het
Dnaaf10 A G 11: 17,177,263 (GRCm39) N207S possibly damaging Het
Ece2 A T 16: 20,462,477 (GRCm39) H732L probably benign Het
Etv3 T G 3: 87,443,322 (GRCm39) L302R possibly damaging Het
Fam135b A G 15: 71,333,985 (GRCm39) S1070P probably damaging Het
Fhip1b A T 7: 105,039,089 (GRCm39) I50N probably damaging Het
Gm11567 T A 11: 99,770,437 (GRCm39) I125N unknown Het
Grm3 A G 5: 9,620,536 (GRCm39) L236P probably benign Het
Hip1 T A 5: 135,461,939 (GRCm39) R97* probably null Het
Hoxa5 T C 6: 52,181,197 (GRCm39) Y45C probably damaging Het
Ighg1 T A 12: 113,292,654 (GRCm39) H305L probably damaging Het
Inpp5b T A 4: 124,676,229 (GRCm39) C362S probably benign Het
Kif1c A G 11: 70,599,273 (GRCm39) K391E probably benign Het
Klf9 T C 19: 23,119,246 (GRCm39) V43A probably benign Het
Krt28 T A 11: 99,265,320 (GRCm39) I116F probably damaging Het
Lct A T 1: 128,222,969 (GRCm39) D1439E probably damaging Het
Liph G A 16: 21,784,745 (GRCm39) T284M possibly damaging Het
Lrrc75b T C 10: 75,393,055 (GRCm39) K98R possibly damaging Het
Lypd4 T C 7: 24,564,604 (GRCm39) Q178R probably benign Het
Map1a T A 2: 121,136,524 (GRCm39) S2209T probably damaging Het
Map3k21 C T 8: 126,665,563 (GRCm39) T584I probably benign Het
Map3k6 T C 4: 132,972,855 (GRCm39) V338A probably damaging Het
Mapk8ip3 A T 17: 25,122,285 (GRCm39) V699E possibly damaging Het
Mtarc1 A C 1: 184,543,116 (GRCm39) S71A probably damaging Het
Nckap1l T C 15: 103,363,452 (GRCm39) S53P probably benign Het
Nt5e T C 9: 88,209,740 (GRCm39) M1T probably null Het
Nudt22 T C 19: 6,972,896 (GRCm39) H64R probably damaging Het
Or1o11 A T 17: 37,756,663 (GRCm39) T84S probably damaging Het
Or2t44 A T 11: 58,677,654 (GRCm39) Y198F probably damaging Het
Or2w3 T C 11: 58,557,225 (GRCm39) I280T possibly damaging Het
Or52b1 A T 7: 104,978,772 (GRCm39) V209D probably damaging Het
Or5ac16 A G 16: 59,022,369 (GRCm39) L140P probably damaging Het
Or8k17 T C 2: 86,066,276 (GRCm39) N294S probably damaging Het
Otogl T C 10: 107,722,413 (GRCm39) I314V probably benign Het
Pan2 G T 10: 128,143,969 (GRCm39) E106D probably benign Het
Papss1 T A 3: 131,337,565 (GRCm39) Y554* probably null Het
Pcnx1 T C 12: 81,941,803 (GRCm39) V67A possibly damaging Het
Pdpk1 A C 17: 24,325,829 (GRCm39) Y122* probably null Het
Pkd1l1 A T 11: 8,829,202 (GRCm39) N1463K probably damaging Het
Ptgfrn C A 3: 100,950,678 (GRCm39) M878I probably damaging Het
Ranbp3 G A 17: 57,017,703 (GRCm39) G453E probably benign Het
Rapgef2 T C 3: 79,002,157 (GRCm39) D261G probably damaging Het
Reep2 A G 18: 34,979,271 (GRCm39) S199G probably benign Het
Rnpep G A 1: 135,205,259 (GRCm39) T202I probably damaging Het
Sass6 T A 3: 116,401,145 (GRCm39) probably null Het
Sema3e A G 5: 14,212,257 (GRCm39) D111G probably damaging Het
Slc29a4 A G 5: 142,697,727 (GRCm39) E60G probably damaging Het
Spata31g1 T C 4: 42,971,831 (GRCm39) L388P possibly damaging Het
Spata31h1 T A 10: 82,120,317 (GRCm39) Q4231L probably damaging Het
Sptlc3 T C 2: 139,388,328 (GRCm39) Y107H probably damaging Het
Stx6 T C 1: 155,073,925 (GRCm39) I245T probably benign Het
Tbc1d16 T A 11: 119,049,617 (GRCm39) Q293L probably damaging Het
Tbc1d30 T C 10: 121,132,692 (GRCm39) D224G probably damaging Het
Tbc1d32 T A 10: 56,026,973 (GRCm39) N759Y possibly damaging Het
Tdrd12 G T 7: 35,210,725 (GRCm39) A166E probably damaging Het
Tex14 A G 11: 87,405,046 (GRCm39) R653G probably benign Het
Them6 A T 15: 74,593,654 (GRCm39) R171W probably null Het
Tln2 T C 9: 67,203,640 (GRCm39) T489A probably benign Het
Tmem87a A G 2: 120,234,427 (GRCm39) F39L probably benign Het
Toporsl T A 4: 52,611,515 (GRCm39) C469* probably null Het
Tpr T C 1: 150,299,569 (GRCm39) S1147P probably damaging Het
Trp53bp1 T C 2: 121,067,143 (GRCm39) M528V probably benign Het
Trpm6 T A 19: 18,807,571 (GRCm39) C1039S probably damaging Het
Ttc16 T A 2: 32,665,348 (GRCm39) S5C probably damaging Het
Ttn T C 2: 76,617,412 (GRCm39) Y14607C probably damaging Het
Usp6nl T C 2: 6,435,275 (GRCm39) F345L probably damaging Het
Vmn1r205 C T 13: 22,776,206 (GRCm39) G299R probably benign Het
Vmn2r74 G A 7: 85,606,588 (GRCm39) H253Y probably benign Het
Vps13d A T 4: 144,896,872 (GRCm39) D343E possibly damaging Het
Vwf A G 6: 125,580,381 (GRCm39) E543G Het
Zfat A T 15: 68,052,765 (GRCm39) V343E probably damaging Het
Zfp316 T C 5: 143,249,846 (GRCm39) E139G unknown Het
Zfp943 T A 17: 22,211,813 (GRCm39) C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 (GRCm39) K677E probably benign Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76,078,474 (GRCm39) unclassified probably benign
IGL00595:Syne2 APN 12 75,972,420 (GRCm39) missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76,110,958 (GRCm39) missense probably damaging 1.00
IGL00781:Syne2 APN 12 76,070,836 (GRCm39) missense probably benign 0.00
IGL00823:Syne2 APN 12 76,036,016 (GRCm39) missense probably damaging 0.98
IGL01014:Syne2 APN 12 75,952,051 (GRCm39) missense probably damaging 0.99
IGL01074:Syne2 APN 12 76,078,361 (GRCm39) nonsense probably null
IGL01074:Syne2 APN 12 76,033,785 (GRCm39) missense probably benign 0.00
IGL01324:Syne2 APN 12 76,090,526 (GRCm39) missense probably damaging 1.00
IGL01325:Syne2 APN 12 75,973,288 (GRCm39) missense probably benign 0.01
IGL01331:Syne2 APN 12 75,976,027 (GRCm39) splice site probably benign
IGL01338:Syne2 APN 12 76,107,000 (GRCm39) missense possibly damaging 0.55
IGL01373:Syne2 APN 12 76,033,881 (GRCm39) missense probably damaging 1.00
IGL01446:Syne2 APN 12 76,088,149 (GRCm39) missense probably damaging 1.00
IGL01556:Syne2 APN 12 76,134,589 (GRCm39) missense probably damaging 1.00
IGL01585:Syne2 APN 12 75,995,834 (GRCm39) critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76,051,377 (GRCm39) missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75,956,110 (GRCm39) missense probably benign
IGL01935:Syne2 APN 12 75,972,087 (GRCm39) missense probably damaging 1.00
IGL01941:Syne2 APN 12 76,013,994 (GRCm39) missense probably benign 0.01
IGL01956:Syne2 APN 12 76,144,748 (GRCm39) missense probably damaging 1.00
IGL01967:Syne2 APN 12 75,988,077 (GRCm39) missense probably damaging 1.00
IGL01990:Syne2 APN 12 76,101,707 (GRCm39) missense probably damaging 1.00
IGL02000:Syne2 APN 12 76,062,419 (GRCm39) missense probably damaging 0.99
IGL02063:Syne2 APN 12 76,098,874 (GRCm39) missense probably damaging 0.96
IGL02069:Syne2 APN 12 75,974,186 (GRCm39) missense probably benign 0.13
IGL02120:Syne2 APN 12 75,993,480 (GRCm39) missense probably damaging 1.00
IGL02222:Syne2 APN 12 75,999,617 (GRCm39) missense probably damaging 0.96
IGL02223:Syne2 APN 12 76,155,079 (GRCm39) missense probably benign 0.00
IGL02321:Syne2 APN 12 75,965,773 (GRCm39) missense possibly damaging 0.58
IGL02488:Syne2 APN 12 76,012,512 (GRCm39) missense probably benign 0.24
IGL02491:Syne2 APN 12 76,118,953 (GRCm39) missense probably benign 0.10
IGL02525:Syne2 APN 12 76,147,777 (GRCm39) missense probably damaging 0.99
IGL02578:Syne2 APN 12 76,069,053 (GRCm39) missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76,143,768 (GRCm39) missense probably damaging 1.00
IGL02702:Syne2 APN 12 76,144,698 (GRCm39) missense probably damaging 1.00
IGL02726:Syne2 APN 12 76,062,356 (GRCm39) missense probably damaging 0.99
IGL02795:Syne2 APN 12 76,013,323 (GRCm39) missense probably damaging 0.99
IGL02803:Syne2 APN 12 76,078,320 (GRCm39) missense probably damaging 1.00
IGL02814:Syne2 APN 12 75,992,150 (GRCm39) missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75,976,111 (GRCm39) missense probably benign 0.00
IGL03131:Syne2 APN 12 76,104,264 (GRCm39) missense probably damaging 1.00
IGL03152:Syne2 APN 12 76,012,486 (GRCm39) missense probably benign 0.12
IGL03216:Syne2 APN 12 75,989,735 (GRCm39) splice site probably benign
IGL03228:Syne2 APN 12 76,026,686 (GRCm39) missense probably benign 0.01
IGL03259:Syne2 APN 12 76,035,853 (GRCm39) missense probably benign 0.05
IGL03374:Syne2 APN 12 76,121,360 (GRCm39) missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75,972,209 (GRCm39) missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75,977,406 (GRCm39) missense probably benign 0.02
B5639:Syne2 UTSW 12 75,976,564 (GRCm39) missense probably benign
K3955:Syne2 UTSW 12 75,977,439 (GRCm39) missense probably damaging 1.00
P0026:Syne2 UTSW 12 75,926,994 (GRCm39) splice site probably benign
PIT4514001:Syne2 UTSW 12 76,151,789 (GRCm39) missense probably damaging 0.99
R0089:Syne2 UTSW 12 76,010,650 (GRCm39) missense probably damaging 1.00
R0110:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0113:Syne2 UTSW 12 76,080,496 (GRCm39) missense probably damaging 1.00
R0113:Syne2 UTSW 12 75,977,352 (GRCm39) missense probably damaging 1.00
R0141:Syne2 UTSW 12 75,988,072 (GRCm39) missense probably damaging 1.00
R0211:Syne2 UTSW 12 76,144,731 (GRCm39) missense probably damaging 1.00
R0219:Syne2 UTSW 12 76,088,778 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0279:Syne2 UTSW 12 76,142,387 (GRCm39) missense probably damaging 1.00
R0319:Syne2 UTSW 12 76,110,936 (GRCm39) missense probably damaging 0.99
R0325:Syne2 UTSW 12 76,009,415 (GRCm39) missense probably benign 0.00
R0329:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0330:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0361:Syne2 UTSW 12 75,965,384 (GRCm39) missense probably benign 0.22
R0363:Syne2 UTSW 12 76,118,981 (GRCm39) missense probably damaging 0.98
R0367:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R0371:Syne2 UTSW 12 75,980,619 (GRCm39) missense probably damaging 1.00
R0374:Syne2 UTSW 12 75,968,000 (GRCm39) nonsense probably null
R0388:Syne2 UTSW 12 76,033,749 (GRCm39) missense probably benign 0.41
R0411:Syne2 UTSW 12 76,106,358 (GRCm39) splice site probably null
R0432:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R0469:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0492:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0496:Syne2 UTSW 12 76,085,714 (GRCm39) missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76,080,365 (GRCm39) splice site probably benign
R0505:Syne2 UTSW 12 76,146,238 (GRCm39) missense probably damaging 1.00
R0510:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0518:Syne2 UTSW 12 76,155,636 (GRCm39) critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76,070,895 (GRCm39) missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75,977,778 (GRCm39) missense probably benign 0.00
R0557:Syne2 UTSW 12 75,976,075 (GRCm39) missense probably benign 0.04
R0567:Syne2 UTSW 12 75,937,004 (GRCm39) missense probably damaging 0.98
R0599:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0602:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0608:Syne2 UTSW 12 76,010,587 (GRCm39) missense probably damaging 1.00
R0614:Syne2 UTSW 12 75,959,127 (GRCm39) splice site probably null
R0636:Syne2 UTSW 12 75,977,757 (GRCm39) missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75,934,977 (GRCm39) missense probably benign
R0654:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0658:Syne2 UTSW 12 76,141,110 (GRCm39) missense probably damaging 1.00
R0666:Syne2 UTSW 12 75,969,787 (GRCm39) missense probably damaging 0.99
R0707:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0714:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0841:Syne2 UTSW 12 76,121,209 (GRCm39) splice site probably benign
R0848:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0848:Syne2 UTSW 12 76,144,733 (GRCm39) frame shift probably null
R1077:Syne2 UTSW 12 76,088,809 (GRCm39) missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76,156,609 (GRCm39) missense probably benign 0.00
R1144:Syne2 UTSW 12 76,013,298 (GRCm39) missense probably benign 0.04
R1194:Syne2 UTSW 12 75,981,287 (GRCm39) missense probably damaging 1.00
R1247:Syne2 UTSW 12 76,014,264 (GRCm39) missense probably benign 0.39
R1276:Syne2 UTSW 12 75,987,963 (GRCm39) critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76,080,417 (GRCm39) missense probably damaging 1.00
R1442:Syne2 UTSW 12 75,993,489 (GRCm39) missense probably damaging 1.00
R1448:Syne2 UTSW 12 76,098,952 (GRCm39) missense possibly damaging 0.56
R1448:Syne2 UTSW 12 76,067,099 (GRCm39) splice site probably null
R1522:Syne2 UTSW 12 76,150,557 (GRCm39) missense probably damaging 0.98
R1528:Syne2 UTSW 12 76,012,874 (GRCm39) missense probably benign 0.00
R1636:Syne2 UTSW 12 76,051,506 (GRCm39) missense probably benign 0.01
R1637:Syne2 UTSW 12 76,042,776 (GRCm39) missense probably damaging 1.00
R1650:Syne2 UTSW 12 75,951,033 (GRCm39) nonsense probably null
R1654:Syne2 UTSW 12 76,147,868 (GRCm39) missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76,101,713 (GRCm39) missense probably benign 0.26
R1750:Syne2 UTSW 12 76,099,579 (GRCm39) missense probably damaging 1.00
R1772:Syne2 UTSW 12 75,985,503 (GRCm39) missense probably benign 0.19
R1797:Syne2 UTSW 12 76,010,557 (GRCm39) missense probably benign 0.00
R1830:Syne2 UTSW 12 76,156,636 (GRCm39) missense probably damaging 1.00
R1837:Syne2 UTSW 12 76,014,434 (GRCm39) missense probably damaging 0.99
R1908:Syne2 UTSW 12 76,141,053 (GRCm39) critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75,946,020 (GRCm39) missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76,121,318 (GRCm39) missense probably damaging 1.00
R1950:Syne2 UTSW 12 75,999,644 (GRCm39) missense probably benign
R1958:Syne2 UTSW 12 76,016,319 (GRCm39) missense probably benign 0.11
R2018:Syne2 UTSW 12 76,121,353 (GRCm39) missense probably damaging 1.00
R2037:Syne2 UTSW 12 76,072,343 (GRCm39) missense probably benign 0.04
R2067:Syne2 UTSW 12 75,935,116 (GRCm39) critical splice donor site probably null
R2073:Syne2 UTSW 12 76,062,353 (GRCm39) missense possibly damaging 0.54
R2099:Syne2 UTSW 12 76,026,747 (GRCm39) missense probably benign 0.06
R2102:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R2134:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2135:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2157:Syne2 UTSW 12 76,141,230 (GRCm39) missense probably damaging 1.00
R2173:Syne2 UTSW 12 76,147,763 (GRCm39) splice site probably benign
R2248:Syne2 UTSW 12 76,143,678 (GRCm39) missense probably damaging 1.00
R2276:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76,142,311 (GRCm39) missense probably damaging 1.00
R2877:Syne2 UTSW 12 76,047,605 (GRCm39) missense probably benign 0.00
R2884:Syne2 UTSW 12 76,010,533 (GRCm39) missense probably benign 0.00
R3119:Syne2 UTSW 12 75,956,058 (GRCm39) missense probably benign 0.01
R3499:Syne2 UTSW 12 76,101,752 (GRCm39) splice site probably null
R3827:Syne2 UTSW 12 76,033,805 (GRCm39) missense probably benign 0.02
R3847:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3849:Syne2 UTSW 12 76,092,839 (GRCm39) nonsense probably null
R3850:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3859:Syne2 UTSW 12 75,976,558 (GRCm39) missense possibly damaging 0.55
R3861:Syne2 UTSW 12 76,013,253 (GRCm39) missense probably damaging 0.98
R4078:Syne2 UTSW 12 76,082,398 (GRCm39) missense probably damaging 1.00
R4116:Syne2 UTSW 12 75,977,853 (GRCm39) missense probably damaging 1.00
R4326:Syne2 UTSW 12 75,999,516 (GRCm39) missense probably damaging 1.00
R4335:Syne2 UTSW 12 76,074,866 (GRCm39) missense probably damaging 1.00
R4410:Syne2 UTSW 12 76,141,167 (GRCm39) missense probably damaging 1.00
R4412:Syne2 UTSW 12 76,152,834 (GRCm39) missense probably benign 0.01
R4444:Syne2 UTSW 12 76,069,804 (GRCm39) missense probably damaging 1.00
R4595:Syne2 UTSW 12 76,013,845 (GRCm39) missense possibly damaging 0.88
R4604:Syne2 UTSW 12 76,014,484 (GRCm39) missense probably damaging 0.99
R4606:Syne2 UTSW 12 76,036,027 (GRCm39) missense probably damaging 1.00
R4651:Syne2 UTSW 12 76,036,013 (GRCm39) missense probably damaging 0.99
R4656:Syne2 UTSW 12 76,078,147 (GRCm39) missense probably damaging 1.00
R4675:Syne2 UTSW 12 75,996,075 (GRCm39) missense probably damaging 1.00
R4790:Syne2 UTSW 12 76,067,165 (GRCm39) missense probably benign 0.19
R4791:Syne2 UTSW 12 75,956,018 (GRCm39) missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75,945,941 (GRCm39) missense probably benign 0.04
R4836:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4880:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4881:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4899:Syne2 UTSW 12 75,900,875 (GRCm39) missense probably benign 0.03
R4934:Syne2 UTSW 12 75,946,046 (GRCm39) missense probably benign 0.14
R4981:Syne2 UTSW 12 75,987,993 (GRCm39) missense probably damaging 0.98
R4996:Syne2 UTSW 12 75,990,724 (GRCm39) missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75,955,905 (GRCm39) unclassified probably benign
R5066:Syne2 UTSW 12 76,013,325 (GRCm39) missense probably benign 0.05
R5095:Syne2 UTSW 12 75,999,600 (GRCm39) missense probably damaging 0.99
R5151:Syne2 UTSW 12 76,090,484 (GRCm39) missense probably benign 0.06
R5193:Syne2 UTSW 12 76,141,194 (GRCm39) missense probably damaging 1.00
R5267:Syne2 UTSW 12 75,985,515 (GRCm39) missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76,146,112 (GRCm39) missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76,106,213 (GRCm39) missense probably damaging 0.98
R5434:Syne2 UTSW 12 76,018,649 (GRCm39) missense probably damaging 1.00
R5441:Syne2 UTSW 12 76,035,917 (GRCm39) missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75,934,946 (GRCm39) missense probably benign 0.13
R5497:Syne2 UTSW 12 75,927,163 (GRCm39) missense probably benign 0.19
R5506:Syne2 UTSW 12 75,985,495 (GRCm39) missense probably benign 0.01
R5509:Syne2 UTSW 12 75,968,018 (GRCm39) missense probably damaging 1.00
R5518:Syne2 UTSW 12 75,991,944 (GRCm39) missense possibly damaging 0.88
R5561:Syne2 UTSW 12 76,141,232 (GRCm39) nonsense probably null
R5581:Syne2 UTSW 12 75,991,859 (GRCm39) missense probably benign 0.01
R5625:Syne2 UTSW 12 76,141,886 (GRCm39) missense probably benign 0.06
R5665:Syne2 UTSW 12 76,154,991 (GRCm39) critical splice donor site probably null
R5666:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5670:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5691:Syne2 UTSW 12 76,074,630 (GRCm39) frame shift probably null
R5696:Syne2 UTSW 12 76,040,919 (GRCm39) missense probably benign 0.00
R5720:Syne2 UTSW 12 76,014,441 (GRCm39) missense probably benign 0.03
R5739:Syne2 UTSW 12 76,044,239 (GRCm39) missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75,927,065 (GRCm39) splice site probably null
R5846:Syne2 UTSW 12 76,074,898 (GRCm39) missense probably benign 0.01
R5850:Syne2 UTSW 12 76,144,749 (GRCm39) missense probably damaging 1.00
R5889:Syne2 UTSW 12 76,119,026 (GRCm39) nonsense probably null
R5912:Syne2 UTSW 12 75,955,721 (GRCm39) critical splice donor site probably null
R5931:Syne2 UTSW 12 76,055,639 (GRCm39) missense probably benign 0.37
R5985:Syne2 UTSW 12 76,012,933 (GRCm39) missense probably damaging 0.96
R5988:Syne2 UTSW 12 75,976,191 (GRCm39) critical splice donor site probably null
R5990:Syne2 UTSW 12 76,070,918 (GRCm39) missense probably benign 0.10
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6132:Syne2 UTSW 12 75,991,921 (GRCm39) missense probably benign 0.14
R6136:Syne2 UTSW 12 75,952,099 (GRCm39) missense probably benign 0.24
R6229:Syne2 UTSW 12 75,967,994 (GRCm39) missense probably benign 0.00
R6252:Syne2 UTSW 12 76,016,210 (GRCm39) missense probably benign 0.39
R6271:Syne2 UTSW 12 75,937,155 (GRCm39) missense probably damaging 1.00
R6320:Syne2 UTSW 12 76,108,424 (GRCm39) missense probably damaging 0.96
R6339:Syne2 UTSW 12 76,035,927 (GRCm39) missense probably benign 0.34
R6380:Syne2 UTSW 12 76,151,754 (GRCm39) missense probably damaging 0.98
R6394:Syne2 UTSW 12 76,037,269 (GRCm39) missense probably benign 0.09
R6419:Syne2 UTSW 12 76,143,740 (GRCm39) missense probably damaging 1.00
R6426:Syne2 UTSW 12 75,969,857 (GRCm39) missense probably null 0.97
R6434:Syne2 UTSW 12 76,088,230 (GRCm39) missense probably damaging 0.99
R6437:Syne2 UTSW 12 76,037,188 (GRCm39) missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75,990,675 (GRCm39) missense probably damaging 0.97
R6501:Syne2 UTSW 12 76,074,621 (GRCm39) splice site probably null
R6552:Syne2 UTSW 12 75,937,015 (GRCm39) missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76,121,221 (GRCm39) missense probably damaging 1.00
R6810:Syne2 UTSW 12 75,989,659 (GRCm39) missense probably benign 0.00
R6831:Syne2 UTSW 12 76,013,568 (GRCm39) missense probably benign 0.39
R6861:Syne2 UTSW 12 75,956,040 (GRCm39) missense probably damaging 1.00
R6875:Syne2 UTSW 12 76,082,404 (GRCm39) missense probably damaging 0.99
R6892:Syne2 UTSW 12 76,009,302 (GRCm39) missense probably damaging 0.98
R6899:Syne2 UTSW 12 76,142,503 (GRCm39) splice site probably null
R6906:Syne2 UTSW 12 76,042,760 (GRCm39) missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76,110,969 (GRCm39) missense probably benign 0.04
R6925:Syne2 UTSW 12 75,900,906 (GRCm39) missense possibly damaging 0.58
R6949:Syne2 UTSW 12 76,012,771 (GRCm39) missense probably benign 0.00
R6952:Syne2 UTSW 12 75,974,205 (GRCm39) missense possibly damaging 0.76
R6996:Syne2 UTSW 12 76,074,786 (GRCm39) missense probably damaging 0.99
R7080:Syne2 UTSW 12 76,099,501 (GRCm39) missense probably benign 0.00
R7083:Syne2 UTSW 12 75,990,662 (GRCm39) missense probably damaging 1.00
R7090:Syne2 UTSW 12 75,989,125 (GRCm39) missense probably benign
R7144:Syne2 UTSW 12 76,052,152 (GRCm39) missense probably benign 0.03
R7154:Syne2 UTSW 12 76,106,231 (GRCm39) missense possibly damaging 0.63
R7177:Syne2 UTSW 12 76,018,654 (GRCm39) nonsense probably null
R7190:Syne2 UTSW 12 76,113,361 (GRCm39) missense probably benign 0.01
R7206:Syne2 UTSW 12 76,051,531 (GRCm39) missense probably benign 0.02
R7208:Syne2 UTSW 12 76,078,172 (GRCm39) splice site probably null
R7230:Syne2 UTSW 12 75,980,674 (GRCm39) missense probably benign 0.12
R7260:Syne2 UTSW 12 75,991,853 (GRCm39) missense probably damaging 1.00
R7272:Syne2 UTSW 12 76,095,417 (GRCm39) missense probably benign 0.00
R7296:Syne2 UTSW 12 76,149,810 (GRCm39) missense probably benign 0.00
R7322:Syne2 UTSW 12 76,030,798 (GRCm39) missense probably damaging 1.00
R7329:Syne2 UTSW 12 76,013,758 (GRCm39) missense probably benign 0.01
R7332:Syne2 UTSW 12 76,014,529 (GRCm39) critical splice donor site probably null
R7381:Syne2 UTSW 12 75,973,263 (GRCm39) missense probably benign 0.11
R7401:Syne2 UTSW 12 76,014,155 (GRCm39) missense probably damaging 0.98
R7403:Syne2 UTSW 12 75,962,020 (GRCm39) missense not run
R7429:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7429:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7430:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7430:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7438:Syne2 UTSW 12 76,062,337 (GRCm39) missense probably benign 0.04
R7447:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R7466:Syne2 UTSW 12 76,092,960 (GRCm39) missense possibly damaging 0.92
R7493:Syne2 UTSW 12 76,012,654 (GRCm39) missense probably benign 0.00
R7502:Syne2 UTSW 12 76,141,100 (GRCm39) missense probably damaging 1.00
R7543:Syne2 UTSW 12 75,953,616 (GRCm39) missense possibly damaging 0.93
R7569:Syne2 UTSW 12 75,974,164 (GRCm39) missense probably benign 0.00
R7599:Syne2 UTSW 12 76,013,145 (GRCm39) missense probably benign 0.04
R7618:Syne2 UTSW 12 75,992,108 (GRCm39) missense probably benign 0.01
R7639:Syne2 UTSW 12 75,981,273 (GRCm39) missense probably damaging 1.00
R7698:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R7702:Syne2 UTSW 12 76,037,161 (GRCm39) missense probably benign 0.16
R7737:Syne2 UTSW 12 75,989,622 (GRCm39) missense probably damaging 1.00
R7742:Syne2 UTSW 12 76,106,209 (GRCm39) missense probably benign 0.02
R7753:Syne2 UTSW 12 76,085,697 (GRCm39) missense probably benign 0.43
R7755:Syne2 UTSW 12 76,044,181 (GRCm39) missense probably benign 0.19
R7757:Syne2 UTSW 12 76,108,553 (GRCm39) missense possibly damaging 0.87
R7790:Syne2 UTSW 12 75,975,877 (GRCm39) splice site probably null
R7808:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7809:Syne2 UTSW 12 76,014,230 (GRCm39) missense probably benign 0.00
R7811:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7834:Syne2 UTSW 12 76,014,021 (GRCm39) missense probably benign 0.00
R7853:Syne2 UTSW 12 76,078,278 (GRCm39) missense probably damaging 1.00
R7867:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7896:Syne2 UTSW 12 76,082,397 (GRCm39) missense probably damaging 0.99
R7903:Syne2 UTSW 12 76,110,958 (GRCm39) missense probably damaging 1.00
R7944:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7945:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7963:Syne2 UTSW 12 76,067,174 (GRCm39) missense probably benign 0.38
R7996:Syne2 UTSW 12 76,051,441 (GRCm39) missense probably damaging 1.00
R7998:Syne2 UTSW 12 76,134,632 (GRCm39) missense probably damaging 1.00
R8010:Syne2 UTSW 12 75,977,512 (GRCm39) missense probably benign 0.39
R8016:Syne2 UTSW 12 75,989,681 (GRCm39) missense probably benign 0.19
R8140:Syne2 UTSW 12 75,959,127 (GRCm39) missense possibly damaging 0.63
R8141:Syne2 UTSW 12 76,108,442 (GRCm39) missense possibly damaging 0.66
R8206:Syne2 UTSW 12 76,062,365 (GRCm39) missense probably benign 0.03
R8258:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8259:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8320:Syne2 UTSW 12 76,150,604 (GRCm39) missense probably damaging 0.99
R8464:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8465:Syne2 UTSW 12 75,900,898 (GRCm39) missense possibly damaging 0.92
R8486:Syne2 UTSW 12 76,088,881 (GRCm39) nonsense probably null
R8488:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8511:Syne2 UTSW 12 76,055,647 (GRCm39) missense probably benign 0.03
R8540:Syne2 UTSW 12 76,141,148 (GRCm39) missense probably damaging 1.00
R8711:Syne2 UTSW 12 76,104,258 (GRCm39) missense probably damaging 1.00
R8722:Syne2 UTSW 12 75,972,095 (GRCm39) missense probably benign 0.04
R8827:Syne2 UTSW 12 76,095,357 (GRCm39) missense probably benign 0.00
R8867:Syne2 UTSW 12 75,989,620 (GRCm39) missense probably damaging 1.00
R8878:Syne2 UTSW 12 75,952,067 (GRCm39) missense probably benign
R8924:Syne2 UTSW 12 75,943,444 (GRCm39) missense probably damaging 0.97
R8966:Syne2 UTSW 12 76,146,197 (GRCm39) missense probably damaging 1.00
R9007:Syne2 UTSW 12 76,146,224 (GRCm39) missense possibly damaging 0.82
R9019:Syne2 UTSW 12 75,999,618 (GRCm39) missense possibly damaging 0.93
R9057:Syne2 UTSW 12 75,937,167 (GRCm39) missense probably damaging 1.00
R9067:Syne2 UTSW 12 75,950,994 (GRCm39) missense probably damaging 1.00
R9081:Syne2 UTSW 12 76,016,290 (GRCm39) nonsense probably null
R9091:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9123:Syne2 UTSW 12 76,040,838 (GRCm39) missense probably damaging 1.00
R9147:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9148:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9163:Syne2 UTSW 12 76,009,349 (GRCm39) missense possibly damaging 0.88
R9192:Syne2 UTSW 12 76,156,703 (GRCm39) missense probably damaging 1.00
R9248:Syne2 UTSW 12 76,154,230 (GRCm39) intron probably benign
R9270:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9292:Syne2 UTSW 12 75,997,823 (GRCm39) missense probably benign
R9397:Syne2 UTSW 12 76,040,849 (GRCm39) missense possibly damaging 0.59
R9454:Syne2 UTSW 12 76,141,844 (GRCm39) nonsense probably null
R9454:Syne2 UTSW 12 76,067,275 (GRCm39) missense probably damaging 0.99
R9478:Syne2 UTSW 12 76,154,387 (GRCm39) missense probably damaging 0.96
R9492:Syne2 UTSW 12 75,995,839 (GRCm39) missense possibly damaging 0.77
R9573:Syne2 UTSW 12 75,927,134 (GRCm39) missense probably damaging 1.00
R9611:Syne2 UTSW 12 76,080,460 (GRCm39) missense probably benign 0.05
R9623:Syne2 UTSW 12 75,986,760 (GRCm39) missense probably benign 0.12
R9647:Syne2 UTSW 12 76,151,875 (GRCm39) missense possibly damaging 0.55
R9652:Syne2 UTSW 12 76,101,620 (GRCm39) missense probably benign 0.00
R9667:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R9701:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
R9794:Syne2 UTSW 12 76,047,617 (GRCm39) missense probably benign 0.04
R9802:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
X0019:Syne2 UTSW 12 76,020,061 (GRCm39) missense probably benign 0.41
X0026:Syne2 UTSW 12 76,147,790 (GRCm39) missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75,974,285 (GRCm39) critical splice donor site probably null
X0066:Syne2 UTSW 12 76,143,701 (GRCm39) missense probably damaging 1.00
Z1176:Syne2 UTSW 12 76,087,157 (GRCm39) missense possibly damaging 0.48
Z1176:Syne2 UTSW 12 76,014,315 (GRCm39) missense probably benign 0.01
Z1177:Syne2 UTSW 12 76,020,197 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,144,748 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,110,912 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ATGGGAAGCAAGCACTATCCC -3'
(R):5'- GTCCTCTTGGCCCAATTTGG -3'

Sequencing Primer
(F):5'- TGAGCCACATCCCTAACTTAAAATG -3'
(R):5'- TGGCCCAATTTGGTCCTTAG -3'
Posted On 2016-11-08