Incidental Mutation 'R5642:Ddx41'
ID440781
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Synonyms2900024F02Rik
MMRRC Submission 043290-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5642 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55530410-55536658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55535895 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 108 (K108E)
Ref Sequence ENSEMBL: ENSMUSP00000153348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021956
AA Change: K97E

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: K97E

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021957
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224686
Predicted Effect possibly damaging
Transcript: ENSMUST00000224765
AA Change: K108E

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225783
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Inpp5b T A 4: 124,782,436 C362S probably benign Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map1a T A 2: 121,306,043 S2209T probably damaging Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Slc29a4 A G 5: 142,711,972 E60G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Tmem87a A G 2: 120,403,946 F39L probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trp53bp1 T C 2: 121,236,662 M528V probably benign Het
Trpm6 T A 19: 18,830,207 C1039S probably damaging Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55531399 missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55532467 missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55532357 missense probably benign 0.04
R0081:Ddx41 UTSW 13 55535380 missense possibly damaging 0.58
R0097:Ddx41 UTSW 13 55535878 splice site probably benign
R0412:Ddx41 UTSW 13 55530608 missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55533006 missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55531299 splice site probably benign
R1330:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R1812:Ddx41 UTSW 13 55535954 missense probably benign 0.03
R2011:Ddx41 UTSW 13 55534093 splice site probably null
R2224:Ddx41 UTSW 13 55531401 missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55534300 missense probably benign 0.03
R2983:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3032:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3916:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55531270 missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55533144 missense probably damaging 1.00
R4569:Ddx41 UTSW 13 55536021 missense possibly damaging 0.88
R4823:Ddx41 UTSW 13 55532055 missense probably benign 0.02
R4837:Ddx41 UTSW 13 55531648 missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55535291 missense probably benign 0.00
R5926:Ddx41 UTSW 13 55534299 missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55532061 missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R7254:Ddx41 UTSW 13 55533956 nonsense probably null
R7640:Ddx41 UTSW 13 55534239 missense possibly damaging 0.81
R7803:Ddx41 UTSW 13 55531921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTACCTCGGCCTTCAG -3'
(R):5'- AACCTGAGTTCCGGACAGAC -3'

Sequencing Primer
(F):5'- GCCTTCAGCCACACTCTCCAG -3'
(R):5'- CTTGGCTCTGAGGGACACTG -3'
Posted On2016-11-08