Incidental Mutation 'R5643:Olfr1188'
ID440822
Institutional Source Beutler Lab
Gene Symbol Olfr1188
Ensembl Gene ENSMUSG00000068809
Gene Nameolfactory receptor 1188
SynonymsMOR238-2, GA_x6K02T2Q125-50046879-50047784
MMRRC Submission 043291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5643 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88556935-88560815 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 88559505 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000150850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090701] [ENSMUST00000217131]
Predicted Effect probably benign
Transcript: ENSMUST00000090701
AA Change: M12K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088202
Gene: ENSMUSG00000068809
AA Change: M12K

DomainStartEndE-ValueType
Pfam:7tm_4 36 309 5.9e-49 PFAM
Pfam:7tm_1 46 292 1.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217131
AA Change: M1K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (110/117)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,010,657 K3102E possibly damaging Het
Akap13 T C 7: 75,702,154 probably null Het
Akp3 A T 1: 87,127,763 T511S unknown Het
Alkal2 T A 12: 30,884,890 L36Q probably damaging Het
Arhgef17 A T 7: 100,880,011 V523E probably damaging Het
Asah1 G T 8: 41,360,295 T27K possibly damaging Het
Bag2 A G 1: 33,746,953 V96A probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
C4b T C 17: 34,742,417 I189M probably benign Het
Calcr A G 6: 3,708,538 I216T probably damaging Het
Cdk5rap2 T A 4: 70,266,733 D1160V probably damaging Het
Cep128 A T 12: 91,348,851 I87K probably damaging Het
Cep170b C G 12: 112,740,841 H1256Q probably benign Het
Chd2 A T 7: 73,484,484 V705E probably damaging Het
Clec12b T A 6: 129,379,960 I172L probably benign Het
Cobl A T 11: 12,306,948 probably benign Het
Col5a2 T A 1: 45,390,042 D972V probably damaging Het
Csrp1 A T 1: 135,751,059 N174I probably damaging Het
Dnah7a T A 1: 53,405,707 H3946L probably benign Het
Dnajc21 A T 15: 10,461,915 D133E probably benign Het
Dvl3 T A 16: 20,526,276 I353N probably damaging Het
Elavl3 A T 9: 22,018,733 S292T probably benign Het
Ephb2 T C 4: 136,771,612 N52S probably damaging Het
Gaa T A 11: 119,280,535 M671K possibly damaging Het
Gabrg3 T C 7: 56,773,284 D222G possibly damaging Het
Gk5 C T 9: 96,140,656 Q182* probably null Het
Gm14403 A T 2: 177,507,261 H50L possibly damaging Het
Gzma T C 13: 113,098,260 T66A probably damaging Het
Hint2 T C 4: 43,656,445 probably benign Het
Hnmt A T 2: 24,014,239 W137R probably damaging Het
Hoga1 T C 19: 42,059,963 V90A probably benign Het
Idua A T 5: 108,680,224 probably benign Het
Kif1a A C 1: 93,055,767 S669R probably damaging Het
Klhdc7b A T 15: 89,387,659 M915L possibly damaging Het
Klhl41 A G 2: 69,670,471 Y92C probably damaging Het
Klrc2 A T 6: 129,656,457 C186S probably damaging Het
Lmo7 A G 14: 101,929,336 probably benign Het
Lrriq1 T C 10: 103,215,440 M484V probably benign Het
Lzts1 A G 8: 69,139,077 S140P possibly damaging Het
Mgat5b T A 11: 116,973,400 V464E probably damaging Het
Mms19 A T 19: 41,955,866 D298E possibly damaging Het
Muc5ac T C 7: 141,793,715 probably null Het
Mycbp2 T A 14: 103,287,334 K597I probably damaging Het
Myo18a C A 11: 77,854,687 D1619E probably benign Het
Nfx1 T C 4: 40,984,973 W366R probably null Het
Nipbl C T 15: 8,358,907 V410I probably benign Het
Olfr1037 T C 2: 86,085,159 N206S probably damaging Het
Olfr116 T A 17: 37,624,432 I68F probably benign Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1443 A T 19: 12,680,972 Y288F probably damaging Het
Olfr648 T C 7: 104,179,884 I175V probably benign Het
Olfr850 A T 9: 19,477,557 M231K probably benign Het
Otog A T 7: 46,287,447 T1527S probably damaging Het
P2ry12 A T 3: 59,218,095 M53K possibly damaging Het
Pask A G 1: 93,337,343 probably null Het
Pcca G A 14: 122,887,069 C684Y probably damaging Het
Pcdhb10 A G 18: 37,413,166 T432A possibly damaging Het
Peak1 T C 9: 56,258,755 N630D probably damaging Het
Plbd2 A T 5: 120,493,166 probably null Het
Plekhg5 T C 4: 152,104,340 V200A probably benign Het
Pola2 A G 19: 5,961,170 V42A probably benign Het
Ppfibp2 T A 7: 107,737,890 W572R probably damaging Het
Ppp6r1 C T 7: 4,633,772 E679K probably benign Het
Pramef6 A T 4: 143,895,767 H339Q probably damaging Het
Prdx3 G A 19: 60,871,525 A70V probably damaging Het
Prkd2 T C 7: 16,843,792 F57L probably benign Het
Prodh2 A G 7: 30,506,746 T324A possibly damaging Het
Ptdss1 T C 13: 66,972,540 F267L probably damaging Het
Rai14 T A 15: 10,593,051 H169L probably benign Het
Rere A G 4: 150,617,243 H1360R probably damaging Het
Rfc3 C T 5: 151,649,979 V40I probably benign Het
Rims1 T A 1: 22,538,509 T219S probably damaging Het
Rnf169 T C 7: 99,927,131 R289G possibly damaging Het
Senp7 T C 16: 56,184,149 silent Het
Sfmbt2 A T 2: 10,568,373 I571F probably damaging Het
Slc11a2 C A 15: 100,403,187 K328N probably benign Het
Slc25a10 A G 11: 120,496,376 probably benign Het
Slc38a8 T C 8: 119,480,749 *433W probably null Het
Slco1a5 A C 6: 142,237,594 probably null Het
Smc6 T A 12: 11,289,994 N434K probably benign Het
Syndig1 A T 2: 149,899,508 I5F possibly damaging Het
Syt5 T C 7: 4,543,019 Q124R probably benign Het
Taok3 A C 5: 117,206,720 M171L probably benign Het
Tbrg1 T C 9: 37,649,413 D389G probably benign Het
Tcaf2 G A 6: 42,642,773 R107C possibly damaging Het
Tex14 C A 11: 87,535,626 H1159Q probably damaging Het
Tmprss11d T A 5: 86,326,529 M190L probably benign Het
Ttn T A 2: 76,938,523 T2856S probably damaging Het
Ubr4 T A 4: 139,444,687 M2997K probably damaging Het
Unc5c C T 3: 141,678,125 A88V probably damaging Het
Use1 T C 8: 71,367,754 probably benign Het
Vmn1r43 T C 6: 89,870,372 N44S probably damaging Het
Vmn1r89 T A 7: 13,220,219 V294D possibly damaging Het
Vmn2r11 A T 5: 109,047,003 V819E probably damaging Het
Vmn2r120 T A 17: 57,524,977 M271L probably benign Het
Vmn2r52 T C 7: 10,171,132 Y260C probably damaging Het
Vmn2r67 T A 7: 85,149,943 R519* probably null Het
Vmn2r69 T A 7: 85,407,196 D578V probably damaging Het
Vmn2r85 T C 10: 130,426,474 Y132C probably damaging Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp318 T A 17: 46,409,244 probably benign Het
Zfp810 A T 9: 22,283,171 S74T probably benign Het
Other mutations in Olfr1188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Olfr1188 APN 2 88560065 missense probably benign 0.02
R1525:Olfr1188 UTSW 2 88559641 missense probably damaging 1.00
R1530:Olfr1188 UTSW 2 88559483 missense probably benign 0.23
R1703:Olfr1188 UTSW 2 88560255 missense possibly damaging 0.56
R1750:Olfr1188 UTSW 2 88560058 missense possibly damaging 0.94
R4626:Olfr1188 UTSW 2 88559832 missense possibly damaging 0.69
R4645:Olfr1188 UTSW 2 88560378 missense probably damaging 0.98
R4934:Olfr1188 UTSW 2 88559586 missense probably benign 0.00
R5644:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R6539:Olfr1188 UTSW 2 88559520 missense probably damaging 1.00
R7079:Olfr1188 UTSW 2 88559509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTTCCCTTTGGTATGGCATG -3'
(R):5'- CCAGCATCTTAGGGATTGTGC -3'

Sequencing Primer
(F):5'- TGGTATGGCATGAAACAAAATAATTC -3'
(R):5'- TTGTGCAAGAGGAATAACATGCATC -3'
Posted On2016-11-08