Incidental Mutation 'R5643:Prodh2'
ID440853
Institutional Source Beutler Lab
Gene Symbol Prodh2
Ensembl Gene ENSMUSG00000036892
Gene Nameproline dehydrogenase (oxidase) 2
Synonyms2510028N04Rik, POX1, 2510038B11Rik, MmPOX1
MMRRC Submission 043291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5643 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30493622-30513402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30506746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000062214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058280] [ENSMUST00000130839] [ENSMUST00000131040] [ENSMUST00000133318] [ENSMUST00000142575]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058280
AA Change: T324A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062214
Gene: ENSMUSG00000036892
AA Change: T324A

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
Pfam:Pro_dh 87 440 3.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122876
SMART Domains Protein: ENSMUSP00000114278
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
Pfam:Pro_dh 1 82 2.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130839
SMART Domains Protein: ENSMUSP00000117480
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131040
SMART Domains Protein: ENSMUSP00000116662
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
Pfam:Pro_dh 91 260 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133318
SMART Domains Protein: ENSMUSP00000122546
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142514
Predicted Effect probably benign
Transcript: ENSMUST00000142575
SMART Domains Protein: ENSMUSP00000114778
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Pfam:Pro_dh 147 284 6.5e-14 PFAM
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (110/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the first step in the catabolism of trans-4-hydroxy-L-proline, an amino acid derivative obtained through food intake and collagen turnover. One of the downstream products of this catabolism is glyoxylate, which in people with disorders of glyoxalate metabolism can lead to an increase in oxalate levels and the formation of calcium-oxalate kidney stones. Therefore, this gene may serve as a therapeutic target against primary hyperoxalurias (PH). This gene is similar to proline dehydrogenase (oxidase) 1, a mitochondrial enzyme that catalyzes the first step in proline catabolism. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,010,657 K3102E possibly damaging Het
Akap13 T C 7: 75,702,154 probably null Het
Akp3 A T 1: 87,127,763 T511S unknown Het
Alkal2 T A 12: 30,884,890 L36Q probably damaging Het
Arhgef17 A T 7: 100,880,011 V523E probably damaging Het
Asah1 G T 8: 41,360,295 T27K possibly damaging Het
Bag2 A G 1: 33,746,953 V96A probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
C4b T C 17: 34,742,417 I189M probably benign Het
Calcr A G 6: 3,708,538 I216T probably damaging Het
Cdk5rap2 T A 4: 70,266,733 D1160V probably damaging Het
Cep128 A T 12: 91,348,851 I87K probably damaging Het
Cep170b C G 12: 112,740,841 H1256Q probably benign Het
Chd2 A T 7: 73,484,484 V705E probably damaging Het
Clec12b T A 6: 129,379,960 I172L probably benign Het
Cobl A T 11: 12,306,948 probably benign Het
Col5a2 T A 1: 45,390,042 D972V probably damaging Het
Csrp1 A T 1: 135,751,059 N174I probably damaging Het
Dnah7a T A 1: 53,405,707 H3946L probably benign Het
Dnajc21 A T 15: 10,461,915 D133E probably benign Het
Dvl3 T A 16: 20,526,276 I353N probably damaging Het
Elavl3 A T 9: 22,018,733 S292T probably benign Het
Ephb2 T C 4: 136,771,612 N52S probably damaging Het
Gaa T A 11: 119,280,535 M671K possibly damaging Het
Gabrg3 T C 7: 56,773,284 D222G possibly damaging Het
Gk5 C T 9: 96,140,656 Q182* probably null Het
Gm14403 A T 2: 177,507,261 H50L possibly damaging Het
Gzma T C 13: 113,098,260 T66A probably damaging Het
Hint2 T C 4: 43,656,445 probably benign Het
Hnmt A T 2: 24,014,239 W137R probably damaging Het
Hoga1 T C 19: 42,059,963 V90A probably benign Het
Idua A T 5: 108,680,224 probably benign Het
Kif1a A C 1: 93,055,767 S669R probably damaging Het
Klhdc7b A T 15: 89,387,659 M915L possibly damaging Het
Klhl41 A G 2: 69,670,471 Y92C probably damaging Het
Klrc2 A T 6: 129,656,457 C186S probably damaging Het
Lmo7 A G 14: 101,929,336 probably benign Het
Lrriq1 T C 10: 103,215,440 M484V probably benign Het
Lzts1 A G 8: 69,139,077 S140P possibly damaging Het
Mgat5b T A 11: 116,973,400 V464E probably damaging Het
Mms19 A T 19: 41,955,866 D298E possibly damaging Het
Muc5ac T C 7: 141,793,715 probably null Het
Mycbp2 T A 14: 103,287,334 K597I probably damaging Het
Myo18a C A 11: 77,854,687 D1619E probably benign Het
Nfx1 T C 4: 40,984,973 W366R probably null Het
Nipbl C T 15: 8,358,907 V410I probably benign Het
Olfr1037 T C 2: 86,085,159 N206S probably damaging Het
Olfr116 T A 17: 37,624,432 I68F probably benign Het
Olfr1188 T A 2: 88,559,505 M1K probably null Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1443 A T 19: 12,680,972 Y288F probably damaging Het
Olfr648 T C 7: 104,179,884 I175V probably benign Het
Olfr850 A T 9: 19,477,557 M231K probably benign Het
Otog A T 7: 46,287,447 T1527S probably damaging Het
P2ry12 A T 3: 59,218,095 M53K possibly damaging Het
Pask A G 1: 93,337,343 probably null Het
Pcca G A 14: 122,887,069 C684Y probably damaging Het
Pcdhb10 A G 18: 37,413,166 T432A possibly damaging Het
Peak1 T C 9: 56,258,755 N630D probably damaging Het
Plbd2 A T 5: 120,493,166 probably null Het
Plekhg5 T C 4: 152,104,340 V200A probably benign Het
Pola2 A G 19: 5,961,170 V42A probably benign Het
Ppfibp2 T A 7: 107,737,890 W572R probably damaging Het
Ppp6r1 C T 7: 4,633,772 E679K probably benign Het
Pramef6 A T 4: 143,895,767 H339Q probably damaging Het
Prdx3 G A 19: 60,871,525 A70V probably damaging Het
Prkd2 T C 7: 16,843,792 F57L probably benign Het
Ptdss1 T C 13: 66,972,540 F267L probably damaging Het
Rai14 T A 15: 10,593,051 H169L probably benign Het
Rere A G 4: 150,617,243 H1360R probably damaging Het
Rfc3 C T 5: 151,649,979 V40I probably benign Het
Rims1 T A 1: 22,538,509 T219S probably damaging Het
Rnf169 T C 7: 99,927,131 R289G possibly damaging Het
Senp7 T C 16: 56,184,149 silent Het
Sfmbt2 A T 2: 10,568,373 I571F probably damaging Het
Slc11a2 C A 15: 100,403,187 K328N probably benign Het
Slc25a10 A G 11: 120,496,376 probably benign Het
Slc38a8 T C 8: 119,480,749 *433W probably null Het
Slco1a5 A C 6: 142,237,594 probably null Het
Smc6 T A 12: 11,289,994 N434K probably benign Het
Syndig1 A T 2: 149,899,508 I5F possibly damaging Het
Syt5 T C 7: 4,543,019 Q124R probably benign Het
Taok3 A C 5: 117,206,720 M171L probably benign Het
Tbrg1 T C 9: 37,649,413 D389G probably benign Het
Tcaf2 G A 6: 42,642,773 R107C possibly damaging Het
Tex14 C A 11: 87,535,626 H1159Q probably damaging Het
Tmprss11d T A 5: 86,326,529 M190L probably benign Het
Ttn T A 2: 76,938,523 T2856S probably damaging Het
Ubr4 T A 4: 139,444,687 M2997K probably damaging Het
Unc5c C T 3: 141,678,125 A88V probably damaging Het
Use1 T C 8: 71,367,754 probably benign Het
Vmn1r43 T C 6: 89,870,372 N44S probably damaging Het
Vmn1r89 T A 7: 13,220,219 V294D possibly damaging Het
Vmn2r11 A T 5: 109,047,003 V819E probably damaging Het
Vmn2r120 T A 17: 57,524,977 M271L probably benign Het
Vmn2r52 T C 7: 10,171,132 Y260C probably damaging Het
Vmn2r67 T A 7: 85,149,943 R519* probably null Het
Vmn2r69 T A 7: 85,407,196 D578V probably damaging Het
Vmn2r85 T C 10: 130,426,474 Y132C probably damaging Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp318 T A 17: 46,409,244 probably benign Het
Zfp810 A T 9: 22,283,171 S74T probably benign Het
Other mutations in Prodh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Prodh2 APN 7 30511203 missense probably damaging 1.00
IGL01949:Prodh2 APN 7 30509765 critical splice acceptor site probably null
IGL02119:Prodh2 APN 7 30506504 missense probably damaging 1.00
IGL02334:Prodh2 APN 7 30506378 missense probably damaging 0.99
IGL03061:Prodh2 APN 7 30512833 nonsense probably null
R0831:Prodh2 UTSW 7 30494224 nonsense probably null
R0964:Prodh2 UTSW 7 30506281 missense probably damaging 1.00
R1295:Prodh2 UTSW 7 30494089 missense probably damaging 1.00
R4414:Prodh2 UTSW 7 30506452 missense probably damaging 1.00
R5035:Prodh2 UTSW 7 30506479 missense possibly damaging 0.49
R5461:Prodh2 UTSW 7 30494523 missense possibly damaging 0.92
R6276:Prodh2 UTSW 7 30506651 missense probably benign 0.07
R6876:Prodh2 UTSW 7 30506500 missense probably damaging 1.00
R7860:Prodh2 UTSW 7 30512639 splice site probably null
R7972:Prodh2 UTSW 7 30511155 missense probably damaging 1.00
R8040:Prodh2 UTSW 7 30506411 missense probably damaging 1.00
X0026:Prodh2 UTSW 7 30493775 missense possibly damaging 0.83
Z1177:Prodh2 UTSW 7 30493990 missense probably damaging 1.00
Z1186:Prodh2 UTSW 7 30506644 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCTAAAGGTAAGTGGCAGGCTC -3'
(R):5'- ATGCTCACTGTGCACTCAC -3'

Sequencing Primer
(F):5'- GTGGGAACTCAGCAACCTGAC -3'
(R):5'- GGCAGAGGTCAATCTCCCTATC -3'
Posted On2016-11-08