Incidental Mutation 'R5643:Zfp318'
ID440903
Institutional Source Beutler Lab
Gene Symbol Zfp318
Ensembl Gene ENSMUSG00000015597
Gene Namezinc finger protein 318
Synonyms2610034E08Rik, D530032D06Rik, TZF
MMRRC Submission 043291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5643 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46383731-46420920 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 46409244 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]
Predicted Effect probably benign
Transcript: ENSMUST00000113481
SMART Domains Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
SCOP:d1eq1a_ 916 995 2e-4 SMART
low complexity region 1018 1055 N/A INTRINSIC
ZnF_U1 1085 1119 5.99e-7 SMART
ZnF_C2H2 1088 1112 4.5e1 SMART
ZnF_U1 1155 1189 2.1e-11 SMART
ZnF_C2H2 1158 1180 4.62e1 SMART
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1358 1371 N/A INTRINSIC
low complexity region 1640 1651 N/A INTRINSIC
Blast:HNHc 1660 1710 3e-17 BLAST
low complexity region 2001 2013 N/A INTRINSIC
low complexity region 2110 2121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136017
Predicted Effect probably benign
Transcript: ENSMUST00000138127
SMART Domains Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
Blast:HOLI 854 1114 8e-19 BLAST
SCOP:d1eq1a_ 916 995 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152472
SMART Domains Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
coiled coil region 3 30 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (110/117)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,010,657 K3102E possibly damaging Het
Akap13 T C 7: 75,702,154 probably null Het
Akp3 A T 1: 87,127,763 T511S unknown Het
Alkal2 T A 12: 30,884,890 L36Q probably damaging Het
Arhgef17 A T 7: 100,880,011 V523E probably damaging Het
Asah1 G T 8: 41,360,295 T27K possibly damaging Het
Bag2 A G 1: 33,746,953 V96A probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
C4b T C 17: 34,742,417 I189M probably benign Het
Calcr A G 6: 3,708,538 I216T probably damaging Het
Cdk5rap2 T A 4: 70,266,733 D1160V probably damaging Het
Cep128 A T 12: 91,348,851 I87K probably damaging Het
Cep170b C G 12: 112,740,841 H1256Q probably benign Het
Chd2 A T 7: 73,484,484 V705E probably damaging Het
Clec12b T A 6: 129,379,960 I172L probably benign Het
Cobl A T 11: 12,306,948 probably benign Het
Col5a2 T A 1: 45,390,042 D972V probably damaging Het
Csrp1 A T 1: 135,751,059 N174I probably damaging Het
Dnah7a T A 1: 53,405,707 H3946L probably benign Het
Dnajc21 A T 15: 10,461,915 D133E probably benign Het
Dvl3 T A 16: 20,526,276 I353N probably damaging Het
Elavl3 A T 9: 22,018,733 S292T probably benign Het
Ephb2 T C 4: 136,771,612 N52S probably damaging Het
Gaa T A 11: 119,280,535 M671K possibly damaging Het
Gabrg3 T C 7: 56,773,284 D222G possibly damaging Het
Gk5 C T 9: 96,140,656 Q182* probably null Het
Gm14403 A T 2: 177,507,261 H50L possibly damaging Het
Gzma T C 13: 113,098,260 T66A probably damaging Het
Hint2 T C 4: 43,656,445 probably benign Het
Hnmt A T 2: 24,014,239 W137R probably damaging Het
Hoga1 T C 19: 42,059,963 V90A probably benign Het
Idua A T 5: 108,680,224 probably benign Het
Kif1a A C 1: 93,055,767 S669R probably damaging Het
Klhdc7b A T 15: 89,387,659 M915L possibly damaging Het
Klhl41 A G 2: 69,670,471 Y92C probably damaging Het
Klrc2 A T 6: 129,656,457 C186S probably damaging Het
Lmo7 A G 14: 101,929,336 probably benign Het
Lrriq1 T C 10: 103,215,440 M484V probably benign Het
Lzts1 A G 8: 69,139,077 S140P possibly damaging Het
Mgat5b T A 11: 116,973,400 V464E probably damaging Het
Mms19 A T 19: 41,955,866 D298E possibly damaging Het
Muc5ac T C 7: 141,793,715 probably null Het
Mycbp2 T A 14: 103,287,334 K597I probably damaging Het
Myo18a C A 11: 77,854,687 D1619E probably benign Het
Nfx1 T C 4: 40,984,973 W366R probably null Het
Nipbl C T 15: 8,358,907 V410I probably benign Het
Olfr1037 T C 2: 86,085,159 N206S probably damaging Het
Olfr116 T A 17: 37,624,432 I68F probably benign Het
Olfr1188 T A 2: 88,559,505 M1K probably null Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1443 A T 19: 12,680,972 Y288F probably damaging Het
Olfr648 T C 7: 104,179,884 I175V probably benign Het
Olfr850 A T 9: 19,477,557 M231K probably benign Het
Otog A T 7: 46,287,447 T1527S probably damaging Het
P2ry12 A T 3: 59,218,095 M53K possibly damaging Het
Pask A G 1: 93,337,343 probably null Het
Pcca G A 14: 122,887,069 C684Y probably damaging Het
Pcdhb10 A G 18: 37,413,166 T432A possibly damaging Het
Peak1 T C 9: 56,258,755 N630D probably damaging Het
Plbd2 A T 5: 120,493,166 probably null Het
Plekhg5 T C 4: 152,104,340 V200A probably benign Het
Pola2 A G 19: 5,961,170 V42A probably benign Het
Ppfibp2 T A 7: 107,737,890 W572R probably damaging Het
Ppp6r1 C T 7: 4,633,772 E679K probably benign Het
Pramef6 A T 4: 143,895,767 H339Q probably damaging Het
Prdx3 G A 19: 60,871,525 A70V probably damaging Het
Prkd2 T C 7: 16,843,792 F57L probably benign Het
Prodh2 A G 7: 30,506,746 T324A possibly damaging Het
Ptdss1 T C 13: 66,972,540 F267L probably damaging Het
Rai14 T A 15: 10,593,051 H169L probably benign Het
Rere A G 4: 150,617,243 H1360R probably damaging Het
Rfc3 C T 5: 151,649,979 V40I probably benign Het
Rims1 T A 1: 22,538,509 T219S probably damaging Het
Rnf169 T C 7: 99,927,131 R289G possibly damaging Het
Senp7 T C 16: 56,184,149 silent Het
Sfmbt2 A T 2: 10,568,373 I571F probably damaging Het
Slc11a2 C A 15: 100,403,187 K328N probably benign Het
Slc25a10 A G 11: 120,496,376 probably benign Het
Slc38a8 T C 8: 119,480,749 *433W probably null Het
Slco1a5 A C 6: 142,237,594 probably null Het
Smc6 T A 12: 11,289,994 N434K probably benign Het
Syndig1 A T 2: 149,899,508 I5F possibly damaging Het
Syt5 T C 7: 4,543,019 Q124R probably benign Het
Taok3 A C 5: 117,206,720 M171L probably benign Het
Tbrg1 T C 9: 37,649,413 D389G probably benign Het
Tcaf2 G A 6: 42,642,773 R107C possibly damaging Het
Tex14 C A 11: 87,535,626 H1159Q probably damaging Het
Tmprss11d T A 5: 86,326,529 M190L probably benign Het
Ttn T A 2: 76,938,523 T2856S probably damaging Het
Ubr4 T A 4: 139,444,687 M2997K probably damaging Het
Unc5c C T 3: 141,678,125 A88V probably damaging Het
Use1 T C 8: 71,367,754 probably benign Het
Vmn1r43 T C 6: 89,870,372 N44S probably damaging Het
Vmn1r89 T A 7: 13,220,219 V294D possibly damaging Het
Vmn2r11 A T 5: 109,047,003 V819E probably damaging Het
Vmn2r120 T A 17: 57,524,977 M271L probably benign Het
Vmn2r52 T C 7: 10,171,132 Y260C probably damaging Het
Vmn2r67 T A 7: 85,149,943 R519* probably null Het
Vmn2r69 T A 7: 85,407,196 D578V probably damaging Het
Vmn2r85 T C 10: 130,426,474 Y132C probably damaging Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp810 A T 9: 22,283,171 S74T probably benign Het
Other mutations in Zfp318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp318 APN 17 46412472 missense probably benign 0.01
IGL00978:Zfp318 APN 17 46413726 missense possibly damaging 0.64
IGL01016:Zfp318 APN 17 46400077 missense probably damaging 1.00
IGL01310:Zfp318 APN 17 46413227 missense possibly damaging 0.81
IGL01453:Zfp318 APN 17 46409016 splice site probably null
IGL01887:Zfp318 APN 17 46399168 missense probably benign 0.07
IGL02025:Zfp318 APN 17 46396810 nonsense probably null
IGL02026:Zfp318 APN 17 46396810 nonsense probably null
IGL02070:Zfp318 APN 17 46396718 missense probably damaging 1.00
IGL02182:Zfp318 APN 17 46396810 nonsense probably null
IGL02187:Zfp318 APN 17 46396810 nonsense probably null
IGL02188:Zfp318 APN 17 46396810 nonsense probably null
IGL02189:Zfp318 APN 17 46396810 nonsense probably null
IGL02190:Zfp318 APN 17 46396810 nonsense probably null
IGL02191:Zfp318 APN 17 46396810 nonsense probably null
IGL02192:Zfp318 APN 17 46396810 nonsense probably null
IGL02203:Zfp318 APN 17 46396810 nonsense probably null
IGL02224:Zfp318 APN 17 46396810 nonsense probably null
IGL02230:Zfp318 APN 17 46396810 nonsense probably null
IGL02231:Zfp318 APN 17 46396810 nonsense probably null
IGL02232:Zfp318 APN 17 46396810 nonsense probably null
IGL02233:Zfp318 APN 17 46396810 nonsense probably null
IGL02234:Zfp318 APN 17 46396810 nonsense probably null
IGL02412:Zfp318 APN 17 46409117 nonsense probably null
IGL02792:Zfp318 APN 17 46409178 missense probably damaging 1.00
IGL02826:Zfp318 APN 17 46398754 missense probably damaging 1.00
Wonton UTSW 17 46409692 missense possibly damaging 0.89
I0000:Zfp318 UTSW 17 46399559 missense probably damaging 1.00
R0206:Zfp318 UTSW 17 46399019 missense probably benign 0.07
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0281:Zfp318 UTSW 17 46412614 missense probably benign 0.05
R0350:Zfp318 UTSW 17 46413198 missense probably benign 0.00
R0383:Zfp318 UTSW 17 46413296 missense probably damaging 0.99
R0453:Zfp318 UTSW 17 46396708 missense probably damaging 0.96
R1014:Zfp318 UTSW 17 46412536 nonsense probably null
R1166:Zfp318 UTSW 17 46409692 missense possibly damaging 0.89
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1327:Zfp318 UTSW 17 46413263 missense probably damaging 1.00
R1330:Zfp318 UTSW 17 46413758 missense possibly damaging 0.90
R1737:Zfp318 UTSW 17 46399477 missense probably benign 0.35
R1800:Zfp318 UTSW 17 46412054 missense probably benign 0.00
R1846:Zfp318 UTSW 17 46413666 missense probably benign 0.00
R1848:Zfp318 UTSW 17 46406055 missense possibly damaging 0.92
R1861:Zfp318 UTSW 17 46411440 missense possibly damaging 0.92
R1913:Zfp318 UTSW 17 46412524 unclassified probably benign
R1913:Zfp318 UTSW 17 46412514 unclassified probably benign
R2059:Zfp318 UTSW 17 46397024 missense probably damaging 0.99
R2085:Zfp318 UTSW 17 46409664 splice site probably null
R2122:Zfp318 UTSW 17 46413371 missense probably benign 0.01
R2339:Zfp318 UTSW 17 46399463 missense probably benign 0.01
R4526:Zfp318 UTSW 17 46412358 missense probably benign 0.00
R4564:Zfp318 UTSW 17 46412815 missense possibly damaging 0.77
R4689:Zfp318 UTSW 17 46399634 missense probably damaging 0.99
R4795:Zfp318 UTSW 17 46412062 missense probably benign 0.07
R5256:Zfp318 UTSW 17 46412069 missense probably benign 0.19
R5317:Zfp318 UTSW 17 46412537 unclassified probably benign
R5323:Zfp318 UTSW 17 46386736 missense probably damaging 0.99
R5436:Zfp318 UTSW 17 46413049 missense possibly damaging 0.95
R5485:Zfp318 UTSW 17 46412254 missense possibly damaging 0.81
R5627:Zfp318 UTSW 17 46413136 missense probably damaging 1.00
R5782:Zfp318 UTSW 17 46412514 unclassified probably benign
R5783:Zfp318 UTSW 17 46412514 unclassified probably benign
R5820:Zfp318 UTSW 17 46412773 missense probably benign
R5895:Zfp318 UTSW 17 46399033 missense probably damaging 1.00
R6189:Zfp318 UTSW 17 46412514 unclassified probably benign
R6385:Zfp318 UTSW 17 46411006 missense probably damaging 1.00
R6428:Zfp318 UTSW 17 46399336 missense probably damaging 1.00
R6471:Zfp318 UTSW 17 46399505 missense probably benign 0.05
R6666:Zfp318 UTSW 17 46409214 missense probably benign 0.01
R6812:Zfp318 UTSW 17 46412542 unclassified probably benign
R6852:Zfp318 UTSW 17 46412533 unclassified probably benign
R6852:Zfp318 UTSW 17 46412534 unclassified probably benign
R6852:Zfp318 UTSW 17 46412538 unclassified probably benign
R6854:Zfp318 UTSW 17 46412542 unclassified probably benign
R6980:Zfp318 UTSW 17 46397212 missense probably damaging 1.00
R6999:Zfp318 UTSW 17 46400043 missense probably damaging 1.00
R7164:Zfp318 UTSW 17 46397306 critical splice donor site probably null
R7164:Zfp318 UTSW 17 46405939 missense probably damaging 1.00
R7175:Zfp318 UTSW 17 46386848 missense probably damaging 1.00
R7233:Zfp318 UTSW 17 46406052 missense probably damaging 0.99
R7339:Zfp318 UTSW 17 46411247 missense probably damaging 0.99
R7426:Zfp318 UTSW 17 46400069 missense probably damaging 1.00
R7600:Zfp318 UTSW 17 46384284 missense possibly damaging 0.86
R7608:Zfp318 UTSW 17 46400009 missense probably damaging 0.96
R7779:Zfp318 UTSW 17 46399894 missense probably benign 0.16
R8057:Zfp318 UTSW 17 46399766 missense possibly damaging 0.72
R8273:Zfp318 UTSW 17 46412375 missense probably damaging 1.00
R8274:Zfp318 UTSW 17 46412989 missense probably benign
R8695:Zfp318 UTSW 17 46412650 missense probably benign 0.01
R8822:Zfp318 UTSW 17 46412905 missense probably benign 0.00
R8851:Zfp318 UTSW 17 46399835 missense probably damaging 1.00
R8913:Zfp318 UTSW 17 46411773 missense probably benign 0.07
R8953:Zfp318 UTSW 17 46420430 missense probably benign 0.38
X0026:Zfp318 UTSW 17 46410638 missense possibly damaging 0.89
X0054:Zfp318 UTSW 17 46412609 missense possibly damaging 0.79
X0065:Zfp318 UTSW 17 46410989 missense probably benign 0.01
Z1176:Zfp318 UTSW 17 46405978 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCCTGTATTAAGAGCCCTAGTTC -3'
(R):5'- GAGAAGCCTCACTTACACTCAG -3'

Sequencing Primer
(F):5'- GAGCCCTAGTTCTACTGAAAGC -3'
(R):5'- AGCCTCACTTACACTCAGATGGTG -3'
Posted On2016-11-08