Incidental Mutation 'R5644:Ccar1'
ID 440983
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Name cell division cycle and apoptosis regulator 1
Synonyms 9430036H15Rik, 2610511G16Rik, Carp1
MMRRC Submission 043292-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R5644 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 62579707-62628065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62607757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 302 (N302S)
Ref Sequence ENSEMBL: ENSMUSP00000151895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000217768] [ENSMUST00000218229] [ENSMUST00000219527]
AlphaFold Q8CH18
Predicted Effect probably benign
Transcript: ENSMUST00000020268
AA Change: N302S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: N302S

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217940
Predicted Effect probably benign
Transcript: ENSMUST00000218229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219441
Predicted Effect probably benign
Transcript: ENSMUST00000219527
AA Change: N302S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A T 10: 14,308,678 (GRCm39) D805E probably damaging Het
Adrb2 A T 18: 62,311,753 (GRCm39) N357K probably benign Het
Ahnak A G 19: 8,988,021 (GRCm39) K3102E possibly damaging Het
Alkal2 T A 12: 30,934,889 (GRCm39) L36Q probably damaging Het
Alkbh8 G T 9: 3,385,384 (GRCm39) V559F probably damaging Het
Apba2 A G 7: 64,365,259 (GRCm39) T346A probably benign Het
Arhgap10 C T 8: 78,137,684 (GRCm39) M302I probably benign Het
Asah1 G T 8: 41,813,332 (GRCm39) T27K possibly damaging Het
Bag2 A G 1: 33,786,034 (GRCm39) V96A probably damaging Het
Bicd1 C T 6: 149,421,901 (GRCm39) A874V probably damaging Het
C4b T C 17: 34,961,391 (GRCm39) I189M probably benign Het
Cacna1a A G 8: 85,189,406 (GRCm39) Y119C probably damaging Het
Calcr A G 6: 3,708,538 (GRCm39) I216T probably damaging Het
Ccdc93 A G 1: 121,411,065 (GRCm39) H446R probably benign Het
Cct6b A T 11: 82,613,281 (GRCm39) L420Q probably benign Het
Cemip T C 7: 83,638,392 (GRCm39) T273A probably benign Het
Cep128 A T 12: 91,315,625 (GRCm39) I87K probably damaging Het
Cfap221 A G 1: 119,860,532 (GRCm39) L698P probably damaging Het
Cfap43 T A 19: 47,784,114 (GRCm39) N473I possibly damaging Het
Clec12b T A 6: 129,356,923 (GRCm39) I172L probably benign Het
Cntnap5b A C 1: 100,311,326 (GRCm39) E606D probably benign Het
Cyp2c67 A C 19: 39,604,138 (GRCm39) V406G possibly damaging Het
Dhx57 T C 17: 80,546,302 (GRCm39) I1308V possibly damaging Het
Dnah7a A T 1: 53,580,138 (GRCm39) M1599K probably benign Het
Dnajc21 A T 15: 10,462,001 (GRCm39) D133E probably benign Het
Dpp8 G A 9: 64,953,017 (GRCm39) W231* probably null Het
Dvl3 T A 16: 20,345,026 (GRCm39) I353N probably damaging Het
Fgd6 T A 10: 93,969,912 (GRCm39) I1187N possibly damaging Het
Fn1 A T 1: 71,666,409 (GRCm39) Y875N probably damaging Het
Gaa T A 11: 119,171,361 (GRCm39) M671K possibly damaging Het
Gm11939 T C 11: 99,450,138 (GRCm39) D52G probably damaging Het
Gm14403 A T 2: 177,199,054 (GRCm39) H50L possibly damaging Het
Gpam A T 19: 55,077,331 (GRCm39) D153E probably benign Het
Gzma T C 13: 113,234,794 (GRCm39) T66A probably damaging Het
Hnmt A T 2: 23,904,251 (GRCm39) W137R probably damaging Het
Hsd17b7 A T 1: 169,783,517 (GRCm39) V297D probably damaging Het
Ighv1-85 A T 12: 115,963,680 (GRCm39) S107T possibly damaging Het
Kif12 T A 4: 63,084,130 (GRCm39) Q624L possibly damaging Het
Kif1b T C 4: 149,322,939 (GRCm39) D660G probably damaging Het
Klf13 T C 7: 63,541,308 (GRCm39) probably benign Het
Klhl41 A G 2: 69,500,815 (GRCm39) Y92C probably damaging Het
Klrc2 A T 6: 129,633,420 (GRCm39) C186S probably damaging Het
Lao1 T A 4: 118,822,433 (GRCm39) probably null Het
Lmo7 A G 14: 102,166,772 (GRCm39) probably benign Het
Lyst A T 13: 13,812,081 (GRCm39) Q831L possibly damaging Het
Lzts1 A G 8: 69,591,729 (GRCm39) S140P possibly damaging Het
Man2b1 T A 8: 85,820,839 (GRCm39) I679N possibly damaging Het
Mgat5b T A 11: 116,864,226 (GRCm39) V464E probably damaging Het
Mrgprb5 G A 7: 47,817,955 (GRCm39) T260I probably benign Het
Mybpc2 T C 7: 44,156,477 (GRCm39) T825A probably benign Het
Mycbp2 T A 14: 103,524,770 (GRCm39) K597I probably damaging Het
Naalad2 G T 9: 18,246,227 (GRCm39) N568K possibly damaging Het
Neurl1a A G 19: 47,167,916 (GRCm39) N4S probably benign Het
Nfx1 T C 4: 40,984,973 (GRCm39) W366R probably null Het
Nipbl C T 15: 8,388,391 (GRCm39) V410I probably benign Het
Nlrp9a A T 7: 26,257,993 (GRCm39) H537L possibly damaging Het
Nxpe4 A G 9: 48,304,050 (GRCm39) N46D probably benign Het
Or14j10 T A 17: 37,935,323 (GRCm39) I68F probably benign Het
Or4c101 T A 2: 88,389,849 (GRCm39) M1K probably null Het
Or4f60 A T 2: 111,902,013 (GRCm39) M305K probably benign Het
Or5ae1 C A 7: 84,565,327 (GRCm39) F113L probably benign Het
Or5b95 A T 19: 12,658,336 (GRCm39) Y288F probably damaging Het
Or5p58 A T 7: 107,694,011 (GRCm39) Y255* probably null Het
Or5p60 A G 7: 107,723,858 (GRCm39) F204S probably benign Het
Or6c2 A T 10: 129,362,972 (GRCm39) N292I probably damaging Het
Or6c76b T A 10: 129,693,296 (GRCm39) V303E probably benign Het
Or8u10 T C 2: 85,915,503 (GRCm39) N206S probably damaging Het
P2ry12 A T 3: 59,125,516 (GRCm39) M53K possibly damaging Het
Pcca G A 14: 123,124,481 (GRCm39) C684Y probably damaging Het
Pdzd7 A G 19: 45,028,619 (GRCm39) S175P probably benign Het
Pgbd1 A G 13: 21,607,322 (GRCm39) C291R probably damaging Het
Plekhg5 T C 4: 152,188,797 (GRCm39) V200A probably benign Het
Pola2 A G 19: 6,011,198 (GRCm39) V42A probably benign Het
Pramel16 C T 4: 143,675,374 (GRCm39) G484D probably benign Het
Prkcd C A 14: 30,329,370 (GRCm39) K23N probably benign Het
Ptdss1 T C 13: 67,120,604 (GRCm39) F267L probably damaging Het
Rad54l C T 4: 115,956,144 (GRCm39) S561N probably benign Het
Rai14 T A 15: 10,593,137 (GRCm39) H169L probably benign Het
Rfc3 C T 5: 151,573,444 (GRCm39) V40I probably benign Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Rtl1 C T 12: 109,558,013 (GRCm39) M1275I probably benign Het
Ryr2 C A 13: 11,610,468 (GRCm39) E4119D probably damaging Het
Senp7 T C 16: 56,004,512 (GRCm39) silent Het
Sfmbt2 A T 2: 10,573,184 (GRCm39) I571F probably damaging Het
Sit1 T A 4: 43,483,562 (GRCm39) T8S probably benign Het
Slc22a30 T C 19: 8,381,980 (GRCm39) H97R possibly damaging Het
Slco1a5 A C 6: 142,183,320 (GRCm39) probably null Het
Smc6 T A 12: 11,339,995 (GRCm39) N434K probably benign Het
Snap91 G T 9: 86,672,206 (GRCm39) probably null Het
Srsf10 T C 4: 135,591,131 (GRCm39) S194P possibly damaging Het
St14 T C 9: 31,017,806 (GRCm39) M205V probably benign Het
Syndig1 A T 2: 149,741,428 (GRCm39) I5F possibly damaging Het
Tbrg1 T C 9: 37,560,709 (GRCm39) D389G probably benign Het
Tcaf2 G A 6: 42,619,707 (GRCm39) R107C possibly damaging Het
Tpmt T A 13: 47,182,435 (GRCm39) D163V probably benign Het
Trim15 T C 17: 37,177,713 (GRCm39) E94G probably damaging Het
Trit1 T C 4: 122,942,965 (GRCm39) I279T probably damaging Het
Trpm8 T A 1: 88,287,461 (GRCm39) F815I possibly damaging Het
Ttn T A 2: 76,768,867 (GRCm39) T2856S probably damaging Het
Ugdh A T 5: 65,574,204 (GRCm39) D446E probably benign Het
Unc5c C T 3: 141,383,886 (GRCm39) A88V probably damaging Het
Vmn1r43 T C 6: 89,847,354 (GRCm39) N44S probably damaging Het
Vmn2r120 T A 17: 57,831,977 (GRCm39) M271L probably benign Het
Wdr74 T A 19: 8,715,240 (GRCm39) V133E probably damaging Het
Zfp607b T C 7: 27,403,194 (GRCm39) L550P probably damaging Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62,589,013 (GRCm39) missense unknown
IGL01291:Ccar1 APN 10 62,592,428 (GRCm39) missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62,612,653 (GRCm39) splice site probably null
IGL01777:Ccar1 APN 10 62,616,356 (GRCm39) missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62,626,714 (GRCm39) missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62,600,112 (GRCm39) missense probably benign 0.20
Lonk UTSW 10 62,600,312 (GRCm39) missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62,619,665 (GRCm39) missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62,592,428 (GRCm39) missense probably damaging 1.00
R0440:Ccar1 UTSW 10 62,616,236 (GRCm39) missense possibly damaging 0.94
R1295:Ccar1 UTSW 10 62,619,661 (GRCm39) critical splice donor site probably null
R1573:Ccar1 UTSW 10 62,586,434 (GRCm39) missense unknown
R1585:Ccar1 UTSW 10 62,586,780 (GRCm39) missense unknown
R1633:Ccar1 UTSW 10 62,586,793 (GRCm39) missense unknown
R1840:Ccar1 UTSW 10 62,599,289 (GRCm39) missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62,600,296 (GRCm39) missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62,612,437 (GRCm39) missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62,612,473 (GRCm39) missense probably benign 0.03
R2041:Ccar1 UTSW 10 62,601,827 (GRCm39) missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62,581,066 (GRCm39) missense unknown
R2327:Ccar1 UTSW 10 62,600,161 (GRCm39) missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62,612,538 (GRCm39) missense probably benign 0.08
R3040:Ccar1 UTSW 10 62,592,273 (GRCm39) missense possibly damaging 0.83
R4647:Ccar1 UTSW 10 62,583,196 (GRCm39) nonsense probably null
R4829:Ccar1 UTSW 10 62,581,114 (GRCm39) missense unknown
R4887:Ccar1 UTSW 10 62,588,997 (GRCm39) missense unknown
R4888:Ccar1 UTSW 10 62,588,997 (GRCm39) missense unknown
R5000:Ccar1 UTSW 10 62,586,784 (GRCm39) missense unknown
R5207:Ccar1 UTSW 10 62,589,060 (GRCm39) missense unknown
R5214:Ccar1 UTSW 10 62,606,740 (GRCm39) missense probably damaging 1.00
R6035:Ccar1 UTSW 10 62,587,564 (GRCm39) missense unknown
R6035:Ccar1 UTSW 10 62,587,564 (GRCm39) missense unknown
R6063:Ccar1 UTSW 10 62,612,496 (GRCm39) missense possibly damaging 0.70
R6330:Ccar1 UTSW 10 62,600,312 (GRCm39) missense probably damaging 1.00
R6370:Ccar1 UTSW 10 62,600,308 (GRCm39) missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62,600,209 (GRCm39) missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62,582,715 (GRCm39) missense unknown
R8054:Ccar1 UTSW 10 62,583,215 (GRCm39) missense unknown
R8089:Ccar1 UTSW 10 62,626,770 (GRCm39) start codon destroyed probably null 0.33
R8202:Ccar1 UTSW 10 62,607,768 (GRCm39) missense possibly damaging 0.94
R8544:Ccar1 UTSW 10 62,586,358 (GRCm39) missense unknown
R8730:Ccar1 UTSW 10 62,601,191 (GRCm39) missense probably damaging 1.00
R9182:Ccar1 UTSW 10 62,621,347 (GRCm39) missense probably damaging 0.98
R9645:Ccar1 UTSW 10 62,602,369 (GRCm39) missense probably benign 0.09
V8831:Ccar1 UTSW 10 62,583,185 (GRCm39) missense unknown
X0017:Ccar1 UTSW 10 62,601,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTGGATCAGAACAACTT -3'
(R):5'- AGAAATCTCCAAACAACACTTATCTT -3'

Sequencing Primer
(F):5'- GTTCACCTCATGCATGCCTAAGAAAG -3'
(R):5'- GGTGAATCCTATTTGTTCATAT -3'
Posted On 2016-11-08