Incidental Mutation 'R5644:Lyst'
ID 440998
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission 043292-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.414) question?
Stock # R5644 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 13764982-13953388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13812081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 831 (Q831L)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110559
AA Change: Q831L

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: Q831L

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223527
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A T 10: 14,308,678 (GRCm39) D805E probably damaging Het
Adrb2 A T 18: 62,311,753 (GRCm39) N357K probably benign Het
Ahnak A G 19: 8,988,021 (GRCm39) K3102E possibly damaging Het
Alkal2 T A 12: 30,934,889 (GRCm39) L36Q probably damaging Het
Alkbh8 G T 9: 3,385,384 (GRCm39) V559F probably damaging Het
Apba2 A G 7: 64,365,259 (GRCm39) T346A probably benign Het
Arhgap10 C T 8: 78,137,684 (GRCm39) M302I probably benign Het
Asah1 G T 8: 41,813,332 (GRCm39) T27K possibly damaging Het
Bag2 A G 1: 33,786,034 (GRCm39) V96A probably damaging Het
Bicd1 C T 6: 149,421,901 (GRCm39) A874V probably damaging Het
C4b T C 17: 34,961,391 (GRCm39) I189M probably benign Het
Cacna1a A G 8: 85,189,406 (GRCm39) Y119C probably damaging Het
Calcr A G 6: 3,708,538 (GRCm39) I216T probably damaging Het
Ccar1 T C 10: 62,607,757 (GRCm39) N302S probably benign Het
Ccdc93 A G 1: 121,411,065 (GRCm39) H446R probably benign Het
Cct6b A T 11: 82,613,281 (GRCm39) L420Q probably benign Het
Cemip T C 7: 83,638,392 (GRCm39) T273A probably benign Het
Cep128 A T 12: 91,315,625 (GRCm39) I87K probably damaging Het
Cfap221 A G 1: 119,860,532 (GRCm39) L698P probably damaging Het
Cfap43 T A 19: 47,784,114 (GRCm39) N473I possibly damaging Het
Clec12b T A 6: 129,356,923 (GRCm39) I172L probably benign Het
Cntnap5b A C 1: 100,311,326 (GRCm39) E606D probably benign Het
Cyp2c67 A C 19: 39,604,138 (GRCm39) V406G possibly damaging Het
Dhx57 T C 17: 80,546,302 (GRCm39) I1308V possibly damaging Het
Dnah7a A T 1: 53,580,138 (GRCm39) M1599K probably benign Het
Dnajc21 A T 15: 10,462,001 (GRCm39) D133E probably benign Het
Dpp8 G A 9: 64,953,017 (GRCm39) W231* probably null Het
Dvl3 T A 16: 20,345,026 (GRCm39) I353N probably damaging Het
Fgd6 T A 10: 93,969,912 (GRCm39) I1187N possibly damaging Het
Fn1 A T 1: 71,666,409 (GRCm39) Y875N probably damaging Het
Gaa T A 11: 119,171,361 (GRCm39) M671K possibly damaging Het
Gm11939 T C 11: 99,450,138 (GRCm39) D52G probably damaging Het
Gm14403 A T 2: 177,199,054 (GRCm39) H50L possibly damaging Het
Gpam A T 19: 55,077,331 (GRCm39) D153E probably benign Het
Gzma T C 13: 113,234,794 (GRCm39) T66A probably damaging Het
Hnmt A T 2: 23,904,251 (GRCm39) W137R probably damaging Het
Hsd17b7 A T 1: 169,783,517 (GRCm39) V297D probably damaging Het
Ighv1-85 A T 12: 115,963,680 (GRCm39) S107T possibly damaging Het
Kif12 T A 4: 63,084,130 (GRCm39) Q624L possibly damaging Het
Kif1b T C 4: 149,322,939 (GRCm39) D660G probably damaging Het
Klf13 T C 7: 63,541,308 (GRCm39) probably benign Het
Klhl41 A G 2: 69,500,815 (GRCm39) Y92C probably damaging Het
Klrc2 A T 6: 129,633,420 (GRCm39) C186S probably damaging Het
Lao1 T A 4: 118,822,433 (GRCm39) probably null Het
Lmo7 A G 14: 102,166,772 (GRCm39) probably benign Het
Lzts1 A G 8: 69,591,729 (GRCm39) S140P possibly damaging Het
Man2b1 T A 8: 85,820,839 (GRCm39) I679N possibly damaging Het
Mgat5b T A 11: 116,864,226 (GRCm39) V464E probably damaging Het
Mrgprb5 G A 7: 47,817,955 (GRCm39) T260I probably benign Het
Mybpc2 T C 7: 44,156,477 (GRCm39) T825A probably benign Het
Mycbp2 T A 14: 103,524,770 (GRCm39) K597I probably damaging Het
Naalad2 G T 9: 18,246,227 (GRCm39) N568K possibly damaging Het
Neurl1a A G 19: 47,167,916 (GRCm39) N4S probably benign Het
Nfx1 T C 4: 40,984,973 (GRCm39) W366R probably null Het
Nipbl C T 15: 8,388,391 (GRCm39) V410I probably benign Het
Nlrp9a A T 7: 26,257,993 (GRCm39) H537L possibly damaging Het
Nxpe4 A G 9: 48,304,050 (GRCm39) N46D probably benign Het
Or14j10 T A 17: 37,935,323 (GRCm39) I68F probably benign Het
Or4c101 T A 2: 88,389,849 (GRCm39) M1K probably null Het
Or4f60 A T 2: 111,902,013 (GRCm39) M305K probably benign Het
Or5ae1 C A 7: 84,565,327 (GRCm39) F113L probably benign Het
Or5b95 A T 19: 12,658,336 (GRCm39) Y288F probably damaging Het
Or5p58 A T 7: 107,694,011 (GRCm39) Y255* probably null Het
Or5p60 A G 7: 107,723,858 (GRCm39) F204S probably benign Het
Or6c2 A T 10: 129,362,972 (GRCm39) N292I probably damaging Het
Or6c76b T A 10: 129,693,296 (GRCm39) V303E probably benign Het
Or8u10 T C 2: 85,915,503 (GRCm39) N206S probably damaging Het
P2ry12 A T 3: 59,125,516 (GRCm39) M53K possibly damaging Het
Pcca G A 14: 123,124,481 (GRCm39) C684Y probably damaging Het
Pdzd7 A G 19: 45,028,619 (GRCm39) S175P probably benign Het
Pgbd1 A G 13: 21,607,322 (GRCm39) C291R probably damaging Het
Plekhg5 T C 4: 152,188,797 (GRCm39) V200A probably benign Het
Pola2 A G 19: 6,011,198 (GRCm39) V42A probably benign Het
Pramel16 C T 4: 143,675,374 (GRCm39) G484D probably benign Het
Prkcd C A 14: 30,329,370 (GRCm39) K23N probably benign Het
Ptdss1 T C 13: 67,120,604 (GRCm39) F267L probably damaging Het
Rad54l C T 4: 115,956,144 (GRCm39) S561N probably benign Het
Rai14 T A 15: 10,593,137 (GRCm39) H169L probably benign Het
Rfc3 C T 5: 151,573,444 (GRCm39) V40I probably benign Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Rtl1 C T 12: 109,558,013 (GRCm39) M1275I probably benign Het
Ryr2 C A 13: 11,610,468 (GRCm39) E4119D probably damaging Het
Senp7 T C 16: 56,004,512 (GRCm39) silent Het
Sfmbt2 A T 2: 10,573,184 (GRCm39) I571F probably damaging Het
Sit1 T A 4: 43,483,562 (GRCm39) T8S probably benign Het
Slc22a30 T C 19: 8,381,980 (GRCm39) H97R possibly damaging Het
Slco1a5 A C 6: 142,183,320 (GRCm39) probably null Het
Smc6 T A 12: 11,339,995 (GRCm39) N434K probably benign Het
Snap91 G T 9: 86,672,206 (GRCm39) probably null Het
Srsf10 T C 4: 135,591,131 (GRCm39) S194P possibly damaging Het
St14 T C 9: 31,017,806 (GRCm39) M205V probably benign Het
Syndig1 A T 2: 149,741,428 (GRCm39) I5F possibly damaging Het
Tbrg1 T C 9: 37,560,709 (GRCm39) D389G probably benign Het
Tcaf2 G A 6: 42,619,707 (GRCm39) R107C possibly damaging Het
Tpmt T A 13: 47,182,435 (GRCm39) D163V probably benign Het
Trim15 T C 17: 37,177,713 (GRCm39) E94G probably damaging Het
Trit1 T C 4: 122,942,965 (GRCm39) I279T probably damaging Het
Trpm8 T A 1: 88,287,461 (GRCm39) F815I possibly damaging Het
Ttn T A 2: 76,768,867 (GRCm39) T2856S probably damaging Het
Ugdh A T 5: 65,574,204 (GRCm39) D446E probably benign Het
Unc5c C T 3: 141,383,886 (GRCm39) A88V probably damaging Het
Vmn1r43 T C 6: 89,847,354 (GRCm39) N44S probably damaging Het
Vmn2r120 T A 17: 57,831,977 (GRCm39) M271L probably benign Het
Wdr74 T A 19: 8,715,240 (GRCm39) V133E probably damaging Het
Zfp607b T C 7: 27,403,194 (GRCm39) L550P probably damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13,823,463 (GRCm39) missense probably benign
IGL00474:Lyst APN 13 13,818,121 (GRCm39) missense possibly damaging 0.48
IGL00484:Lyst APN 13 13,884,188 (GRCm39) missense probably benign 0.02
IGL00492:Lyst APN 13 13,852,760 (GRCm39) missense possibly damaging 0.54
IGL00807:Lyst APN 13 13,825,008 (GRCm39) missense possibly damaging 0.91
IGL00949:Lyst APN 13 13,810,070 (GRCm39) missense possibly damaging 0.87
IGL00952:Lyst APN 13 13,852,692 (GRCm39) missense probably benign 0.05
IGL01305:Lyst APN 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL01317:Lyst APN 13 13,845,455 (GRCm39) missense probably benign
IGL01419:Lyst APN 13 13,810,423 (GRCm39) missense probably benign 0.00
IGL01445:Lyst APN 13 13,826,299 (GRCm39) missense probably benign 0.00
IGL01690:Lyst APN 13 13,917,831 (GRCm39) missense probably damaging 1.00
IGL01791:Lyst APN 13 13,809,887 (GRCm39) missense probably damaging 1.00
IGL01809:Lyst APN 13 13,812,388 (GRCm39) missense probably damaging 1.00
IGL01896:Lyst APN 13 13,810,162 (GRCm39) missense probably benign 0.04
IGL01938:Lyst APN 13 13,812,009 (GRCm39) missense possibly damaging 0.93
IGL01986:Lyst APN 13 13,950,212 (GRCm39) critical splice donor site probably null
IGL02022:Lyst APN 13 13,838,629 (GRCm39) nonsense probably null
IGL02044:Lyst APN 13 13,887,431 (GRCm39) missense probably damaging 1.00
IGL02157:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02185:Lyst APN 13 13,835,678 (GRCm39) nonsense probably null
IGL02215:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02245:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02246:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02247:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02297:Lyst APN 13 13,812,677 (GRCm39) nonsense probably null
IGL02411:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02415:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02419:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02420:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02429:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02501:Lyst APN 13 13,886,230 (GRCm39) missense probably benign 0.02
IGL02522:Lyst APN 13 13,809,290 (GRCm39) missense possibly damaging 0.81
IGL02535:Lyst APN 13 13,824,927 (GRCm39) missense probably benign 0.00
IGL02596:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02601:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02603:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02608:Lyst APN 13 13,887,339 (GRCm39) missense probably damaging 0.98
IGL02622:Lyst APN 13 13,855,975 (GRCm39) missense probably damaging 1.00
IGL02690:Lyst APN 13 13,815,710 (GRCm39) missense possibly damaging 0.58
IGL02715:Lyst APN 13 13,848,905 (GRCm39) splice site probably null
IGL02725:Lyst APN 13 13,935,412 (GRCm39) missense probably damaging 1.00
IGL02729:Lyst APN 13 13,921,194 (GRCm39) missense possibly damaging 0.95
IGL02729:Lyst APN 13 13,848,924 (GRCm39) missense possibly damaging 0.81
IGL02820:Lyst APN 13 13,812,643 (GRCm39) missense probably benign 0.03
IGL02945:Lyst APN 13 13,935,783 (GRCm39) missense possibly damaging 0.48
IGL02981:Lyst APN 13 13,809,496 (GRCm39) missense probably damaging 0.99
IGL03087:Lyst APN 13 13,809,641 (GRCm39) missense probably damaging 1.00
IGL03149:Lyst APN 13 13,856,029 (GRCm39) missense probably benign 0.14
IGL03158:Lyst APN 13 13,826,337 (GRCm39) critical splice donor site probably null
IGL03226:Lyst APN 13 13,884,144 (GRCm39) missense probably benign 0.01
IGL03242:Lyst APN 13 13,831,466 (GRCm39) nonsense probably null
IGL03385:Lyst APN 13 13,831,565 (GRCm39) nonsense probably null
50-cal UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
charcoal UTSW 13 13,871,346 (GRCm39) nonsense probably null
charlotte_gray UTSW 13 13,602,026 (GRCm38) intron probably benign
charzard UTSW 13 13,821,668 (GRCm39) nonsense probably null
grey_wolf UTSW 13 0 () unclassified
lightspeed UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
pardon UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
robin UTSW 13 13,823,387 (GRCm39) nonsense probably null
sooty UTSW 13 0 () unclassified
souris UTSW 13 13,857,808 (GRCm39) unclassified probably benign
Swallow UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
vulpix UTSW 13 13,871,379 (GRCm39) splice site probably null
ANU22:Lyst UTSW 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL02835:Lyst UTSW 13 13,835,685 (GRCm39) missense possibly damaging 0.82
P0031:Lyst UTSW 13 13,838,616 (GRCm39) missense probably damaging 1.00
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0031:Lyst UTSW 13 13,882,741 (GRCm39) missense probably benign 0.14
R0115:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0212:Lyst UTSW 13 13,810,570 (GRCm39) missense possibly damaging 0.93
R0386:Lyst UTSW 13 13,882,799 (GRCm39) splice site probably benign
R0393:Lyst UTSW 13 13,821,664 (GRCm39) missense probably benign 0.01
R0415:Lyst UTSW 13 13,886,195 (GRCm39) splice site probably benign
R0446:Lyst UTSW 13 13,812,633 (GRCm39) missense probably benign 0.00
R0481:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0499:Lyst UTSW 13 13,791,298 (GRCm39) missense probably damaging 1.00
R0506:Lyst UTSW 13 13,812,600 (GRCm39) missense probably benign
R0530:Lyst UTSW 13 13,931,891 (GRCm39) splice site probably benign
R0541:Lyst UTSW 13 13,855,878 (GRCm39) missense probably benign 0.00
R0570:Lyst UTSW 13 13,883,971 (GRCm39) missense probably benign 0.26
R0680:Lyst UTSW 13 13,824,926 (GRCm39) missense probably benign 0.01
R0842:Lyst UTSW 13 13,852,826 (GRCm39) nonsense probably null
R0848:Lyst UTSW 13 13,809,515 (GRCm39) missense probably benign 0.00
R1014:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.49
R1205:Lyst UTSW 13 13,854,787 (GRCm39) missense probably benign
R1251:Lyst UTSW 13 13,809,068 (GRCm39) missense probably benign 0.00
R1304:Lyst UTSW 13 13,926,569 (GRCm39) nonsense probably null
R1398:Lyst UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
R1445:Lyst UTSW 13 13,814,639 (GRCm39) missense possibly damaging 0.94
R1475:Lyst UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
R1479:Lyst UTSW 13 13,809,067 (GRCm39) missense probably benign 0.00
R1484:Lyst UTSW 13 13,852,775 (GRCm39) missense probably benign 0.01
R1498:Lyst UTSW 13 13,824,960 (GRCm39) missense possibly damaging 0.49
R1540:Lyst UTSW 13 13,809,686 (GRCm39) missense possibly damaging 0.81
R1611:Lyst UTSW 13 13,809,482 (GRCm39) missense probably damaging 0.97
R1653:Lyst UTSW 13 13,809,811 (GRCm39) missense probably damaging 1.00
R1669:Lyst UTSW 13 13,818,672 (GRCm39) missense possibly damaging 0.90
R1686:Lyst UTSW 13 13,809,290 (GRCm39) missense possibly damaging 0.81
R1694:Lyst UTSW 13 13,835,746 (GRCm39) missense probably damaging 0.98
R1747:Lyst UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
R1793:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R1871:Lyst UTSW 13 13,826,297 (GRCm39) missense probably benign 0.00
R1905:Lyst UTSW 13 13,808,719 (GRCm39) missense probably benign
R1958:Lyst UTSW 13 13,791,203 (GRCm39) missense probably damaging 1.00
R1969:Lyst UTSW 13 13,904,929 (GRCm39) missense probably damaging 0.99
R2040:Lyst UTSW 13 13,815,807 (GRCm39) missense probably benign 0.00
R2109:Lyst UTSW 13 13,887,405 (GRCm39) missense possibly damaging 0.46
R2116:Lyst UTSW 13 13,810,286 (GRCm39) missense probably damaging 0.99
R2121:Lyst UTSW 13 13,835,556 (GRCm39) missense probably damaging 1.00
R2127:Lyst UTSW 13 13,809,847 (GRCm39) missense probably damaging 1.00
R2187:Lyst UTSW 13 13,883,926 (GRCm39) missense possibly damaging 0.61
R2238:Lyst UTSW 13 13,917,848 (GRCm39) missense probably benign 0.41
R2258:Lyst UTSW 13 13,812,243 (GRCm39) missense probably benign 0.00
R2292:Lyst UTSW 13 13,915,080 (GRCm39) missense probably damaging 1.00
R2368:Lyst UTSW 13 13,871,248 (GRCm39) missense probably damaging 0.96
R2908:Lyst UTSW 13 13,844,458 (GRCm39) missense probably benign 0.03
R3001:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3002:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3024:Lyst UTSW 13 13,833,272 (GRCm39) missense probably benign
R3113:Lyst UTSW 13 13,844,512 (GRCm39) missense probably benign 0.12
R3406:Lyst UTSW 13 13,809,815 (GRCm39) missense possibly damaging 0.56
R3972:Lyst UTSW 13 13,881,210 (GRCm39) missense possibly damaging 0.67
R3978:Lyst UTSW 13 13,808,753 (GRCm39) missense possibly damaging 0.82
R4032:Lyst UTSW 13 13,791,250 (GRCm39) missense probably damaging 1.00
R4192:Lyst UTSW 13 13,915,098 (GRCm39) missense probably damaging 1.00
R4206:Lyst UTSW 13 13,810,574 (GRCm39) missense probably benign 0.03
R4298:Lyst UTSW 13 13,809,472 (GRCm39) missense probably damaging 1.00
R4344:Lyst UTSW 13 13,873,051 (GRCm39) missense probably benign 0.06
R4441:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4445:Lyst UTSW 13 13,884,149 (GRCm39) missense probably benign 0.42
R4477:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4493:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4494:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4495:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4622:Lyst UTSW 13 13,848,983 (GRCm39) missense probably benign 0.01
R4638:Lyst UTSW 13 13,871,379 (GRCm39) splice site probably null
R4658:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4675:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4719:Lyst UTSW 13 13,824,935 (GRCm39) missense probably benign
R4729:Lyst UTSW 13 13,812,486 (GRCm39) missense probably damaging 1.00
R4774:Lyst UTSW 13 13,915,182 (GRCm39) missense probably damaging 1.00
R4811:Lyst UTSW 13 13,951,685 (GRCm39) missense probably benign 0.33
R4877:Lyst UTSW 13 13,857,734 (GRCm39) missense probably damaging 1.00
R4920:Lyst UTSW 13 13,821,645 (GRCm39) missense possibly damaging 0.79
R4933:Lyst UTSW 13 13,933,963 (GRCm39) missense probably benign 0.12
R4933:Lyst UTSW 13 13,812,349 (GRCm39) missense probably damaging 0.98
R4958:Lyst UTSW 13 13,810,048 (GRCm39) missense probably benign 0.00
R4982:Lyst UTSW 13 13,900,539 (GRCm39) missense probably damaging 1.00
R4992:Lyst UTSW 13 13,835,748 (GRCm39) missense probably damaging 1.00
R5024:Lyst UTSW 13 13,808,989 (GRCm39) missense probably benign
R5049:Lyst UTSW 13 13,810,649 (GRCm39) missense probably damaging 1.00
R5079:Lyst UTSW 13 13,931,938 (GRCm39) missense probably benign 0.08
R5254:Lyst UTSW 13 13,857,655 (GRCm39) missense probably benign 0.00
R5266:Lyst UTSW 13 13,835,555 (GRCm39) missense probably damaging 1.00
R5279:Lyst UTSW 13 13,823,387 (GRCm39) nonsense probably null
R5285:Lyst UTSW 13 13,809,011 (GRCm39) missense probably benign 0.01
R5364:Lyst UTSW 13 13,831,439 (GRCm39) missense probably benign 0.35
R5435:Lyst UTSW 13 13,951,649 (GRCm39) missense possibly damaging 0.64
R5516:Lyst UTSW 13 13,818,707 (GRCm39) missense probably benign 0.10
R5524:Lyst UTSW 13 13,921,364 (GRCm39) missense probably benign 0.03
R5591:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5592:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5593:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,933,982 (GRCm39) missense probably benign 0.00
R5659:Lyst UTSW 13 13,809,212 (GRCm39) missense possibly damaging 0.58
R5741:Lyst UTSW 13 13,808,615 (GRCm39) missense probably benign 0.44
R5908:Lyst UTSW 13 13,871,346 (GRCm39) nonsense probably null
R5969:Lyst UTSW 13 13,862,398 (GRCm39) splice site probably null
R6128:Lyst UTSW 13 13,933,964 (GRCm39) missense possibly damaging 0.67
R6271:Lyst UTSW 13 13,833,339 (GRCm39) missense probably benign 0.30
R6315:Lyst UTSW 13 13,818,089 (GRCm39) missense probably benign
R6318:Lyst UTSW 13 13,917,896 (GRCm39) missense possibly damaging 0.88
R6555:Lyst UTSW 13 13,823,510 (GRCm39) missense probably benign 0.01
R6663:Lyst UTSW 13 13,838,701 (GRCm39) splice site probably null
R6701:Lyst UTSW 13 13,856,070 (GRCm39) missense probably benign 0.06
R6711:Lyst UTSW 13 13,809,820 (GRCm39) missense possibly damaging 0.80
R6909:Lyst UTSW 13 13,917,960 (GRCm39) missense probably damaging 1.00
R6915:Lyst UTSW 13 13,900,629 (GRCm39) missense probably benign 0.01
R6929:Lyst UTSW 13 13,917,909 (GRCm39) missense probably damaging 1.00
R6960:Lyst UTSW 13 13,808,663 (GRCm39) missense probably benign 0.12
R7018:Lyst UTSW 13 13,918,044 (GRCm39) critical splice donor site probably null
R7037:Lyst UTSW 13 13,791,251 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,812,293 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,809,485 (GRCm39) missense probably benign 0.34
R7070:Lyst UTSW 13 13,932,029 (GRCm39) missense probably benign 0.23
R7188:Lyst UTSW 13 13,926,675 (GRCm39) missense possibly damaging 0.66
R7201:Lyst UTSW 13 13,883,885 (GRCm39) nonsense probably null
R7210:Lyst UTSW 13 13,831,568 (GRCm39) missense probably damaging 1.00
R7229:Lyst UTSW 13 13,818,094 (GRCm39) missense probably benign 0.00
R7293:Lyst UTSW 13 13,854,822 (GRCm39) missense probably benign 0.01
R7318:Lyst UTSW 13 13,932,028 (GRCm39) missense probably benign 0.13
R7344:Lyst UTSW 13 13,881,140 (GRCm39) missense probably benign
R7426:Lyst UTSW 13 13,812,109 (GRCm39) missense probably benign
R7522:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R7583:Lyst UTSW 13 13,810,472 (GRCm39) missense probably damaging 1.00
R7606:Lyst UTSW 13 13,812,060 (GRCm39) missense probably damaging 1.00
R7636:Lyst UTSW 13 13,791,332 (GRCm39) critical splice donor site probably null
R7658:Lyst UTSW 13 13,905,061 (GRCm39) missense possibly damaging 0.63
R7685:Lyst UTSW 13 13,844,450 (GRCm39) missense probably benign 0.00
R7689:Lyst UTSW 13 13,857,808 (GRCm39) critical splice donor site probably null
R7765:Lyst UTSW 13 13,884,117 (GRCm39) missense possibly damaging 0.75
R7779:Lyst UTSW 13 13,809,128 (GRCm39) missense probably damaging 1.00
R7871:Lyst UTSW 13 13,810,637 (GRCm39) nonsense probably null
R7872:Lyst UTSW 13 13,810,450 (GRCm39) missense probably benign 0.14
R7884:Lyst UTSW 13 13,882,268 (GRCm39) missense probably benign 0.09
R7890:Lyst UTSW 13 13,915,154 (GRCm39) missense probably damaging 0.99
R7916:Lyst UTSW 13 13,821,657 (GRCm39) missense possibly damaging 0.64
R7948:Lyst UTSW 13 13,921,174 (GRCm39) missense possibly damaging 0.59
R7956:Lyst UTSW 13 13,815,788 (GRCm39) missense possibly damaging 0.80
R8048:Lyst UTSW 13 13,862,230 (GRCm39) missense probably benign 0.12
R8085:Lyst UTSW 13 13,808,894 (GRCm39) missense probably damaging 0.98
R8165:Lyst UTSW 13 13,872,945 (GRCm39) missense probably damaging 0.99
R8235:Lyst UTSW 13 13,935,323 (GRCm39) missense possibly damaging 0.69
R8237:Lyst UTSW 13 13,826,317 (GRCm39) missense probably benign 0.00
R8275:Lyst UTSW 13 13,950,667 (GRCm39) missense probably benign 0.02
R8300:Lyst UTSW 13 13,838,643 (GRCm39) missense possibly damaging 0.79
R8350:Lyst UTSW 13 13,824,973 (GRCm39) nonsense probably null
R8526:Lyst UTSW 13 13,935,391 (GRCm39) missense probably damaging 0.99
R8551:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.77
R8723:Lyst UTSW 13 13,887,342 (GRCm39) missense possibly damaging 0.89
R8772:Lyst UTSW 13 13,812,077 (GRCm39) nonsense probably null
R8778:Lyst UTSW 13 13,903,152 (GRCm39) missense possibly damaging 0.89
R8778:Lyst UTSW 13 13,810,361 (GRCm39) missense possibly damaging 0.89
R8801:Lyst UTSW 13 13,835,595 (GRCm39) missense probably benign 0.10
R8837:Lyst UTSW 13 13,852,548 (GRCm39) missense probably benign
R8874:Lyst UTSW 13 13,812,147 (GRCm39) missense probably benign
R8878:Lyst UTSW 13 13,815,661 (GRCm39) missense probably benign 0.00
R8891:Lyst UTSW 13 13,887,435 (GRCm39) missense possibly damaging 0.67
R9077:Lyst UTSW 13 13,857,693 (GRCm39) missense probably benign 0.02
R9127:Lyst UTSW 13 13,808,827 (GRCm39) missense probably damaging 1.00
R9143:Lyst UTSW 13 13,835,750 (GRCm39) missense probably damaging 0.98
R9216:Lyst UTSW 13 13,823,188 (GRCm39) missense probably benign
R9217:Lyst UTSW 13 13,871,245 (GRCm39) missense probably benign 0.01
R9291:Lyst UTSW 13 13,883,938 (GRCm39) missense probably benign 0.01
R9302:Lyst UTSW 13 13,904,947 (GRCm39) missense possibly damaging 0.46
R9370:Lyst UTSW 13 13,935,333 (GRCm39) missense probably damaging 1.00
R9402:Lyst UTSW 13 13,812,463 (GRCm39) missense probably benign
R9457:Lyst UTSW 13 13,862,330 (GRCm39) missense possibly damaging 0.83
R9481:Lyst UTSW 13 13,857,653 (GRCm39) missense possibly damaging 0.68
R9563:Lyst UTSW 13 13,812,408 (GRCm39) missense probably benign 0.36
R9623:Lyst UTSW 13 13,852,587 (GRCm39) missense probably benign
R9661:Lyst UTSW 13 13,808,779 (GRCm39) missense probably benign 0.01
R9682:Lyst UTSW 13 13,831,526 (GRCm39) missense probably benign 0.21
R9743:Lyst UTSW 13 13,809,323 (GRCm39) missense possibly damaging 0.67
R9801:Lyst UTSW 13 13,809,290 (GRCm39) missense probably damaging 0.97
RF001:Lyst UTSW 13 13,810,426 (GRCm39) missense probably benign
RF002:Lyst UTSW 13 13,808,948 (GRCm39) missense probably benign 0.05
X0024:Lyst UTSW 13 13,809,033 (GRCm39) missense probably benign 0.00
X0026:Lyst UTSW 13 13,926,555 (GRCm39) missense probably damaging 0.99
Z1088:Lyst UTSW 13 13,918,018 (GRCm39) missense probably benign 0.09
Z1176:Lyst UTSW 13 13,951,664 (GRCm39) missense probably benign 0.27
Z1176:Lyst UTSW 13 13,814,692 (GRCm39) missense probably damaging 1.00
Z1177:Lyst UTSW 13 13,854,719 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCAGAGTAGGCAGTGTTTGG -3'
(R):5'- AACATCCTGGTGAATGGTCTTTCG -3'

Sequencing Primer
(F):5'- TGGTGTATATACCACACACAGC -3'
(R):5'- TCTCTGAGGCTGGCATAA -3'
Posted On 2016-11-08