Incidental Mutation 'R5644:Lyst'
ID 440998
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission 043292-MU
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448
Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R5644 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 13590397-13778803 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13637496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 831 (Q831L)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110559
AA Change: Q831L

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: Q831L

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223527
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A T 10: 14,432,934 D805E probably damaging Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Ahnak A G 19: 9,010,657 K3102E possibly damaging Het
Alkal2 T A 12: 30,884,890 L36Q probably damaging Het
Alkbh8 G T 9: 3,385,384 V559F probably damaging Het
Apba2 A G 7: 64,715,511 T346A probably benign Het
Arhgap10 C T 8: 77,411,055 M302I probably benign Het
Asah1 G T 8: 41,360,295 T27K possibly damaging Het
Bag2 A G 1: 33,746,953 V96A probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
C4b T C 17: 34,742,417 I189M probably benign Het
Cacna1a A G 8: 84,462,777 Y119C probably damaging Het
Calcr A G 6: 3,708,538 I216T probably damaging Het
Ccar1 T C 10: 62,771,978 N302S probably benign Het
Ccdc93 A G 1: 121,483,336 H446R probably benign Het
Cct6b A T 11: 82,722,455 L420Q probably benign Het
Cemip T C 7: 83,989,184 T273A probably benign Het
Cep128 A T 12: 91,348,851 I87K probably damaging Het
Cfap221 A G 1: 119,932,802 L698P probably damaging Het
Cfap43 T A 19: 47,795,675 N473I possibly damaging Het
Clec12b T A 6: 129,379,960 I172L probably benign Het
Cntnap5b A C 1: 100,383,601 E606D probably benign Het
Cyp2c67 A C 19: 39,615,694 V406G possibly damaging Het
Dhx57 T C 17: 80,238,873 I1308V possibly damaging Het
Dnah7a A T 1: 53,540,979 M1599K probably benign Het
Dnajc21 A T 15: 10,461,915 D133E probably benign Het
Dpp8 G A 9: 65,045,735 W231* probably null Het
Dvl3 T A 16: 20,526,276 I353N probably damaging Het
Fgd6 T A 10: 94,134,050 I1187N possibly damaging Het
Fn1 A T 1: 71,627,250 Y875N probably damaging Het
Gaa T A 11: 119,280,535 M671K possibly damaging Het
Gm11939 T C 11: 99,559,312 D52G probably damaging Het
Gm14403 A T 2: 177,507,261 H50L possibly damaging Het
Gpam A T 19: 55,088,899 D153E probably benign Het
Gzma T C 13: 113,098,260 T66A probably damaging Het
Hnmt A T 2: 24,014,239 W137R probably damaging Het
Hsd17b7 A T 1: 169,955,948 V297D probably damaging Het
Ighv1-85 A T 12: 116,000,060 S107T possibly damaging Het
Kif12 T A 4: 63,165,893 Q624L possibly damaging Het
Kif1b T C 4: 149,238,482 D660G probably damaging Het
Klf13 T C 7: 63,891,560 probably benign Het
Klhl41 A G 2: 69,670,471 Y92C probably damaging Het
Klrc2 A T 6: 129,656,457 C186S probably damaging Het
Lao1 T A 4: 118,965,236 probably null Het
Lmo7 A G 14: 101,929,336 probably benign Het
Lzts1 A G 8: 69,139,077 S140P possibly damaging Het
Man2b1 T A 8: 85,094,210 I679N possibly damaging Het
Mgat5b T A 11: 116,973,400 V464E probably damaging Het
Mrgprb5 G A 7: 48,168,207 T260I probably benign Het
Mybpc2 T C 7: 44,507,053 T825A probably benign Het
Mycbp2 T A 14: 103,287,334 K597I probably damaging Het
Naalad2 G T 9: 18,334,931 N568K possibly damaging Het
Neurl1a A G 19: 47,179,477 N4S probably benign Het
Nfx1 T C 4: 40,984,973 W366R probably null Het
Nipbl C T 15: 8,358,907 V410I probably benign Het
Nlrp9a A T 7: 26,558,568 H537L possibly damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr1037 T C 2: 86,085,159 N206S probably damaging Het
Olfr116 T A 17: 37,624,432 I68F probably benign Het
Olfr1188 T A 2: 88,559,505 M1K probably null Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1443 A T 19: 12,680,972 Y288F probably damaging Het
Olfr290 C A 7: 84,916,119 F113L probably benign Het
Olfr482 A T 7: 108,094,804 Y255* probably null Het
Olfr484 A G 7: 108,124,651 F204S probably benign Het
Olfr791 A T 10: 129,527,103 N292I probably damaging Het
Olfr813 T A 10: 129,857,427 V303E probably benign Het
P2ry12 A T 3: 59,218,095 M53K possibly damaging Het
Pcca G A 14: 122,887,069 C684Y probably damaging Het
Pdzd7 A G 19: 45,040,180 S175P probably benign Het
Pgbd1 A G 13: 21,423,152 C291R probably damaging Het
Plekhg5 T C 4: 152,104,340 V200A probably benign Het
Pola2 A G 19: 5,961,170 V42A probably benign Het
Pramef25 C T 4: 143,948,804 G484D probably benign Het
Prkcd C A 14: 30,607,413 K23N probably benign Het
Ptdss1 T C 13: 66,972,540 F267L probably damaging Het
Rad54l C T 4: 116,098,947 S561N probably benign Het
Rai14 T A 15: 10,593,051 H169L probably benign Het
Rfc3 C T 5: 151,649,979 V40I probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Rtl1 C T 12: 109,591,579 M1275I probably benign Het
Ryr2 C A 13: 11,595,582 E4119D probably damaging Het
Senp7 T C 16: 56,184,149 silent Het
Sfmbt2 A T 2: 10,568,373 I571F probably damaging Het
Sit1 T A 4: 43,483,562 T8S probably benign Het
Slc22a30 T C 19: 8,404,616 H97R possibly damaging Het
Slco1a5 A C 6: 142,237,594 probably null Het
Smc6 T A 12: 11,289,994 N434K probably benign Het
Snap91 G T 9: 86,790,153 probably null Het
Srsf10 T C 4: 135,863,820 S194P possibly damaging Het
St14 T C 9: 31,106,510 M205V probably benign Het
Syndig1 A T 2: 149,899,508 I5F possibly damaging Het
Tbrg1 T C 9: 37,649,413 D389G probably benign Het
Tcaf2 G A 6: 42,642,773 R107C possibly damaging Het
Tpmt T A 13: 47,028,959 D163V probably benign Het
Trim15 T C 17: 36,866,821 E94G probably damaging Het
Trit1 T C 4: 123,049,172 I279T probably damaging Het
Trpm8 T A 1: 88,359,739 F815I possibly damaging Het
Ttn T A 2: 76,938,523 T2856S probably damaging Het
Ugdh A T 5: 65,416,861 D446E probably benign Het
Unc5c C T 3: 141,678,125 A88V probably damaging Het
Vmn1r43 T C 6: 89,870,372 N44S probably damaging Het
Vmn2r120 T A 17: 57,524,977 M271L probably benign Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp607b T C 7: 27,703,769 L550P probably damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
pardon UTSW 13 13677952 missense probably benign 0.00
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
R7018:Lyst UTSW 13 13743459 critical splice donor site probably null
R7037:Lyst UTSW 13 13616666 missense probably damaging 1.00
R7045:Lyst UTSW 13 13634900 missense probably benign 0.34
R7045:Lyst UTSW 13 13637708 missense probably damaging 1.00
R7070:Lyst UTSW 13 13757444 missense probably benign 0.23
R7188:Lyst UTSW 13 13752090 missense possibly damaging 0.66
R7201:Lyst UTSW 13 13709300 nonsense probably null
R7210:Lyst UTSW 13 13656983 missense probably damaging 1.00
R7229:Lyst UTSW 13 13643509 missense probably benign 0.00
R7293:Lyst UTSW 13 13680237 missense probably benign 0.01
R7318:Lyst UTSW 13 13757443 missense probably benign 0.13
R7344:Lyst UTSW 13 13706555 missense probably benign
R7426:Lyst UTSW 13 13637524 missense probably benign
R7522:Lyst UTSW 13 13647083 nonsense probably null
R7583:Lyst UTSW 13 13635887 missense probably damaging 1.00
R7606:Lyst UTSW 13 13637475 missense probably damaging 1.00
R7636:Lyst UTSW 13 13616747 critical splice donor site probably null
R7658:Lyst UTSW 13 13730476 missense possibly damaging 0.63
R7685:Lyst UTSW 13 13669865 missense probably benign 0.00
R7689:Lyst UTSW 13 13683223 critical splice donor site probably null
R7765:Lyst UTSW 13 13709532 missense possibly damaging 0.75
R7779:Lyst UTSW 13 13634543 missense probably damaging 1.00
R7871:Lyst UTSW 13 13636052 nonsense probably null
R7872:Lyst UTSW 13 13635865 missense probably benign 0.14
R7884:Lyst UTSW 13 13707683 missense probably benign 0.09
R7890:Lyst UTSW 13 13740569 missense probably damaging 0.99
R7916:Lyst UTSW 13 13647072 missense possibly damaging 0.64
R7948:Lyst UTSW 13 13746589 missense possibly damaging 0.59
R7956:Lyst UTSW 13 13641203 missense possibly damaging 0.80
R8048:Lyst UTSW 13 13687645 missense probably benign 0.12
R8085:Lyst UTSW 13 13634309 missense probably damaging 0.98
R8165:Lyst UTSW 13 13698360 missense probably damaging 0.99
R8235:Lyst UTSW 13 13760738 missense possibly damaging 0.69
R8237:Lyst UTSW 13 13651732 missense probably benign 0.00
R8275:Lyst UTSW 13 13776082 missense probably benign 0.02
R8300:Lyst UTSW 13 13664058 missense possibly damaging 0.79
R8350:Lyst UTSW 13 13650388 nonsense probably null
R8526:Lyst UTSW 13 13760806 missense probably damaging 0.99
R8551:Lyst UTSW 13 13634060 missense possibly damaging 0.77
R8723:Lyst UTSW 13 13712757 missense possibly damaging 0.89
R8772:Lyst UTSW 13 13637492 nonsense probably null
R8778:Lyst UTSW 13 13635776 missense possibly damaging 0.89
R8778:Lyst UTSW 13 13728567 missense possibly damaging 0.89
R8801:Lyst UTSW 13 13661010 missense probably benign 0.10
R8837:Lyst UTSW 13 13677963 missense probably benign
R8874:Lyst UTSW 13 13637562 missense probably benign
R8878:Lyst UTSW 13 13641076 missense probably benign 0.00
R8891:Lyst UTSW 13 13712850 missense possibly damaging 0.67
R9077:Lyst UTSW 13 13683108 missense probably benign 0.02
R9127:Lyst UTSW 13 13634242 missense probably damaging 1.00
R9143:Lyst UTSW 13 13661165 missense probably damaging 0.98
R9216:Lyst UTSW 13 13648603 missense probably benign
R9217:Lyst UTSW 13 13696660 missense probably benign 0.01
R9291:Lyst UTSW 13 13709353 missense probably benign 0.01
R9302:Lyst UTSW 13 13730362 missense possibly damaging 0.46
R9370:Lyst UTSW 13 13760748 missense probably damaging 1.00
R9402:Lyst UTSW 13 13637878 missense probably benign
R9457:Lyst UTSW 13 13687745 missense possibly damaging 0.83
R9481:Lyst UTSW 13 13683068 missense possibly damaging 0.68
R9563:Lyst UTSW 13 13637823 missense probably benign 0.36
R9623:Lyst UTSW 13 13678002 missense probably benign
R9661:Lyst UTSW 13 13634194 missense probably benign 0.01
R9682:Lyst UTSW 13 13656941 missense probably benign 0.21
R9743:Lyst UTSW 13 13634738 missense possibly damaging 0.67
R9801:Lyst UTSW 13 13634705 missense probably damaging 0.97
RF001:Lyst UTSW 13 13635841 missense probably benign
RF002:Lyst UTSW 13 13634363 missense probably benign 0.05
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Z1176:Lyst UTSW 13 13640107 missense probably damaging 1.00
Z1176:Lyst UTSW 13 13777079 missense probably benign 0.27
Z1177:Lyst UTSW 13 13680134 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCAGAGTAGGCAGTGTTTGG -3'
(R):5'- AACATCCTGGTGAATGGTCTTTCG -3'

Sequencing Primer
(F):5'- TGGTGTATATACCACACACAGC -3'
(R):5'- TCTCTGAGGCTGGCATAA -3'
Posted On 2016-11-08