Incidental Mutation 'R5644:Nipbl'
ID 441007
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4933421G18Rik, 4921518A06Rik
MMRRC Submission 043292-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R5644 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 8320101-8473947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8388391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 410 (V410I)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000052965
AA Change: V410I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: V410I

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A T 10: 14,308,678 (GRCm39) D805E probably damaging Het
Adrb2 A T 18: 62,311,753 (GRCm39) N357K probably benign Het
Ahnak A G 19: 8,988,021 (GRCm39) K3102E possibly damaging Het
Alkal2 T A 12: 30,934,889 (GRCm39) L36Q probably damaging Het
Alkbh8 G T 9: 3,385,384 (GRCm39) V559F probably damaging Het
Apba2 A G 7: 64,365,259 (GRCm39) T346A probably benign Het
Arhgap10 C T 8: 78,137,684 (GRCm39) M302I probably benign Het
Asah1 G T 8: 41,813,332 (GRCm39) T27K possibly damaging Het
Bag2 A G 1: 33,786,034 (GRCm39) V96A probably damaging Het
Bicd1 C T 6: 149,421,901 (GRCm39) A874V probably damaging Het
C4b T C 17: 34,961,391 (GRCm39) I189M probably benign Het
Cacna1a A G 8: 85,189,406 (GRCm39) Y119C probably damaging Het
Calcr A G 6: 3,708,538 (GRCm39) I216T probably damaging Het
Ccar1 T C 10: 62,607,757 (GRCm39) N302S probably benign Het
Ccdc93 A G 1: 121,411,065 (GRCm39) H446R probably benign Het
Cct6b A T 11: 82,613,281 (GRCm39) L420Q probably benign Het
Cemip T C 7: 83,638,392 (GRCm39) T273A probably benign Het
Cep128 A T 12: 91,315,625 (GRCm39) I87K probably damaging Het
Cfap221 A G 1: 119,860,532 (GRCm39) L698P probably damaging Het
Cfap43 T A 19: 47,784,114 (GRCm39) N473I possibly damaging Het
Clec12b T A 6: 129,356,923 (GRCm39) I172L probably benign Het
Cntnap5b A C 1: 100,311,326 (GRCm39) E606D probably benign Het
Cyp2c67 A C 19: 39,604,138 (GRCm39) V406G possibly damaging Het
Dhx57 T C 17: 80,546,302 (GRCm39) I1308V possibly damaging Het
Dnah7a A T 1: 53,580,138 (GRCm39) M1599K probably benign Het
Dnajc21 A T 15: 10,462,001 (GRCm39) D133E probably benign Het
Dpp8 G A 9: 64,953,017 (GRCm39) W231* probably null Het
Dvl3 T A 16: 20,345,026 (GRCm39) I353N probably damaging Het
Fgd6 T A 10: 93,969,912 (GRCm39) I1187N possibly damaging Het
Fn1 A T 1: 71,666,409 (GRCm39) Y875N probably damaging Het
Gaa T A 11: 119,171,361 (GRCm39) M671K possibly damaging Het
Gm11939 T C 11: 99,450,138 (GRCm39) D52G probably damaging Het
Gm14403 A T 2: 177,199,054 (GRCm39) H50L possibly damaging Het
Gpam A T 19: 55,077,331 (GRCm39) D153E probably benign Het
Gzma T C 13: 113,234,794 (GRCm39) T66A probably damaging Het
Hnmt A T 2: 23,904,251 (GRCm39) W137R probably damaging Het
Hsd17b7 A T 1: 169,783,517 (GRCm39) V297D probably damaging Het
Ighv1-85 A T 12: 115,963,680 (GRCm39) S107T possibly damaging Het
Kif12 T A 4: 63,084,130 (GRCm39) Q624L possibly damaging Het
Kif1b T C 4: 149,322,939 (GRCm39) D660G probably damaging Het
Klf13 T C 7: 63,541,308 (GRCm39) probably benign Het
Klhl41 A G 2: 69,500,815 (GRCm39) Y92C probably damaging Het
Klrc2 A T 6: 129,633,420 (GRCm39) C186S probably damaging Het
Lao1 T A 4: 118,822,433 (GRCm39) probably null Het
Lmo7 A G 14: 102,166,772 (GRCm39) probably benign Het
Lyst A T 13: 13,812,081 (GRCm39) Q831L possibly damaging Het
Lzts1 A G 8: 69,591,729 (GRCm39) S140P possibly damaging Het
Man2b1 T A 8: 85,820,839 (GRCm39) I679N possibly damaging Het
Mgat5b T A 11: 116,864,226 (GRCm39) V464E probably damaging Het
Mrgprb5 G A 7: 47,817,955 (GRCm39) T260I probably benign Het
Mybpc2 T C 7: 44,156,477 (GRCm39) T825A probably benign Het
Mycbp2 T A 14: 103,524,770 (GRCm39) K597I probably damaging Het
Naalad2 G T 9: 18,246,227 (GRCm39) N568K possibly damaging Het
Neurl1a A G 19: 47,167,916 (GRCm39) N4S probably benign Het
Nfx1 T C 4: 40,984,973 (GRCm39) W366R probably null Het
Nlrp9a A T 7: 26,257,993 (GRCm39) H537L possibly damaging Het
Nxpe4 A G 9: 48,304,050 (GRCm39) N46D probably benign Het
Or14j10 T A 17: 37,935,323 (GRCm39) I68F probably benign Het
Or4c101 T A 2: 88,389,849 (GRCm39) M1K probably null Het
Or4f60 A T 2: 111,902,013 (GRCm39) M305K probably benign Het
Or5ae1 C A 7: 84,565,327 (GRCm39) F113L probably benign Het
Or5b95 A T 19: 12,658,336 (GRCm39) Y288F probably damaging Het
Or5p58 A T 7: 107,694,011 (GRCm39) Y255* probably null Het
Or5p60 A G 7: 107,723,858 (GRCm39) F204S probably benign Het
Or6c2 A T 10: 129,362,972 (GRCm39) N292I probably damaging Het
Or6c76b T A 10: 129,693,296 (GRCm39) V303E probably benign Het
Or8u10 T C 2: 85,915,503 (GRCm39) N206S probably damaging Het
P2ry12 A T 3: 59,125,516 (GRCm39) M53K possibly damaging Het
Pcca G A 14: 123,124,481 (GRCm39) C684Y probably damaging Het
Pdzd7 A G 19: 45,028,619 (GRCm39) S175P probably benign Het
Pgbd1 A G 13: 21,607,322 (GRCm39) C291R probably damaging Het
Plekhg5 T C 4: 152,188,797 (GRCm39) V200A probably benign Het
Pola2 A G 19: 6,011,198 (GRCm39) V42A probably benign Het
Pramel16 C T 4: 143,675,374 (GRCm39) G484D probably benign Het
Prkcd C A 14: 30,329,370 (GRCm39) K23N probably benign Het
Ptdss1 T C 13: 67,120,604 (GRCm39) F267L probably damaging Het
Rad54l C T 4: 115,956,144 (GRCm39) S561N probably benign Het
Rai14 T A 15: 10,593,137 (GRCm39) H169L probably benign Het
Rfc3 C T 5: 151,573,444 (GRCm39) V40I probably benign Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Rtl1 C T 12: 109,558,013 (GRCm39) M1275I probably benign Het
Ryr2 C A 13: 11,610,468 (GRCm39) E4119D probably damaging Het
Senp7 T C 16: 56,004,512 (GRCm39) silent Het
Sfmbt2 A T 2: 10,573,184 (GRCm39) I571F probably damaging Het
Sit1 T A 4: 43,483,562 (GRCm39) T8S probably benign Het
Slc22a30 T C 19: 8,381,980 (GRCm39) H97R possibly damaging Het
Slco1a5 A C 6: 142,183,320 (GRCm39) probably null Het
Smc6 T A 12: 11,339,995 (GRCm39) N434K probably benign Het
Snap91 G T 9: 86,672,206 (GRCm39) probably null Het
Srsf10 T C 4: 135,591,131 (GRCm39) S194P possibly damaging Het
St14 T C 9: 31,017,806 (GRCm39) M205V probably benign Het
Syndig1 A T 2: 149,741,428 (GRCm39) I5F possibly damaging Het
Tbrg1 T C 9: 37,560,709 (GRCm39) D389G probably benign Het
Tcaf2 G A 6: 42,619,707 (GRCm39) R107C possibly damaging Het
Tpmt T A 13: 47,182,435 (GRCm39) D163V probably benign Het
Trim15 T C 17: 37,177,713 (GRCm39) E94G probably damaging Het
Trit1 T C 4: 122,942,965 (GRCm39) I279T probably damaging Het
Trpm8 T A 1: 88,287,461 (GRCm39) F815I possibly damaging Het
Ttn T A 2: 76,768,867 (GRCm39) T2856S probably damaging Het
Ugdh A T 5: 65,574,204 (GRCm39) D446E probably benign Het
Unc5c C T 3: 141,383,886 (GRCm39) A88V probably damaging Het
Vmn1r43 T C 6: 89,847,354 (GRCm39) N44S probably damaging Het
Vmn2r120 T A 17: 57,831,977 (GRCm39) M271L probably benign Het
Wdr74 T A 19: 8,715,240 (GRCm39) V133E probably damaging Het
Zfp607b T C 7: 27,403,194 (GRCm39) L550P probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8,396,157 (GRCm39) missense probably damaging 0.98
IGL00712:Nipbl APN 15 8,398,958 (GRCm39) missense probably damaging 0.97
IGL00789:Nipbl APN 15 8,326,353 (GRCm39) missense probably damaging 1.00
IGL01025:Nipbl APN 15 8,379,939 (GRCm39) missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8,379,981 (GRCm39) missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8,340,693 (GRCm39) missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8,380,023 (GRCm39) missense probably benign
IGL01723:Nipbl APN 15 8,364,555 (GRCm39) missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8,391,305 (GRCm39) missense probably benign 0.13
IGL02398:Nipbl APN 15 8,356,574 (GRCm39) missense probably damaging 1.00
IGL02437:Nipbl APN 15 8,388,558 (GRCm39) missense probably damaging 1.00
IGL02450:Nipbl APN 15 8,373,058 (GRCm39) missense probably damaging 0.99
IGL02477:Nipbl APN 15 8,353,131 (GRCm39) splice site probably null
IGL02547:Nipbl APN 15 8,381,082 (GRCm39) missense probably benign
IGL02678:Nipbl APN 15 8,380,594 (GRCm39) missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8,325,037 (GRCm39) missense probably benign 0.34
IGL03003:Nipbl APN 15 8,379,798 (GRCm39) missense probably damaging 1.00
IGL03117:Nipbl APN 15 8,361,936 (GRCm39) missense probably damaging 1.00
IGL03162:Nipbl APN 15 8,368,463 (GRCm39) missense probably benign 0.37
IGL03224:Nipbl APN 15 8,322,569 (GRCm39) missense probably damaging 0.98
IGL03339:Nipbl APN 15 8,380,360 (GRCm39) missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8,380,216 (GRCm39) missense probably benign
R3620_nipbl_616 UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R0271:Nipbl UTSW 15 8,391,221 (GRCm39) missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347:Nipbl UTSW 15 8,380,216 (GRCm39) missense probably benign
R0422:Nipbl UTSW 15 8,381,112 (GRCm39) missense probably benign
R0486:Nipbl UTSW 15 8,368,354 (GRCm39) splice site probably benign
R0652:Nipbl UTSW 15 8,332,964 (GRCm39) missense probably benign 0.23
R0667:Nipbl UTSW 15 8,390,488 (GRCm39) missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8,322,562 (GRCm39) splice site probably null
R0726:Nipbl UTSW 15 8,381,039 (GRCm39) missense probably benign
R0881:Nipbl UTSW 15 8,337,096 (GRCm39) missense probably damaging 0.98
R0904:Nipbl UTSW 15 8,391,202 (GRCm39) missense probably benign
R0969:Nipbl UTSW 15 8,321,712 (GRCm39) missense probably damaging 1.00
R1401:Nipbl UTSW 15 8,401,657 (GRCm39) missense probably damaging 0.97
R1479:Nipbl UTSW 15 8,379,773 (GRCm39) missense probably benign 0.00
R1495:Nipbl UTSW 15 8,380,764 (GRCm39) missense probably benign 0.00
R1609:Nipbl UTSW 15 8,396,148 (GRCm39) missense probably damaging 1.00
R1679:Nipbl UTSW 15 8,332,396 (GRCm39) missense probably benign 0.31
R1756:Nipbl UTSW 15 8,368,035 (GRCm39) missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8,348,972 (GRCm39) missense probably damaging 1.00
R1835:Nipbl UTSW 15 8,373,001 (GRCm39) missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8,356,616 (GRCm39) missense probably damaging 1.00
R1914:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8,379,771 (GRCm39) missense probably damaging 1.00
R2046:Nipbl UTSW 15 8,353,951 (GRCm39) missense probably benign 0.08
R2076:Nipbl UTSW 15 8,340,691 (GRCm39) missense probably benign 0.11
R2163:Nipbl UTSW 15 8,366,403 (GRCm39) missense probably damaging 0.99
R2170:Nipbl UTSW 15 8,322,702 (GRCm39) missense probably damaging 1.00
R2425:Nipbl UTSW 15 8,380,966 (GRCm39) missense probably benign 0.06
R2475:Nipbl UTSW 15 8,364,490 (GRCm39) missense probably benign 0.05
R2484:Nipbl UTSW 15 8,353,182 (GRCm39) missense probably damaging 0.99
R2970:Nipbl UTSW 15 8,340,723 (GRCm39) missense probably damaging 1.00
R3116:Nipbl UTSW 15 8,373,076 (GRCm39) missense probably benign 0.00
R3620:Nipbl UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R3725:Nipbl UTSW 15 8,325,145 (GRCm39) missense probably damaging 0.97
R3745:Nipbl UTSW 15 8,388,358 (GRCm39) missense probably benign
R3902:Nipbl UTSW 15 8,379,730 (GRCm39) missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8,380,018 (GRCm39) missense probably benign
R4164:Nipbl UTSW 15 8,368,418 (GRCm39) missense probably benign 0.24
R4246:Nipbl UTSW 15 8,361,916 (GRCm39) missense probably damaging 1.00
R4381:Nipbl UTSW 15 8,388,690 (GRCm39) missense probably benign 0.00
R4394:Nipbl UTSW 15 8,391,345 (GRCm39) missense probably benign 0.00
R4439:Nipbl UTSW 15 8,368,208 (GRCm39) missense probably damaging 0.98
R4440:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4441:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4672:Nipbl UTSW 15 8,332,468 (GRCm39) missense probably damaging 1.00
R4749:Nipbl UTSW 15 8,395,313 (GRCm39) missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8,380,981 (GRCm39) missense probably benign
R5428:Nipbl UTSW 15 8,359,780 (GRCm39) missense probably benign 0.00
R5641:Nipbl UTSW 15 8,396,196 (GRCm39) missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5681:Nipbl UTSW 15 8,330,866 (GRCm39) missense probably benign 0.22
R5741:Nipbl UTSW 15 8,354,133 (GRCm39) missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8,364,328 (GRCm39) splice site probably null
R5970:Nipbl UTSW 15 8,326,302 (GRCm39) missense probably benign 0.27
R6041:Nipbl UTSW 15 8,353,748 (GRCm39) missense probably damaging 1.00
R6059:Nipbl UTSW 15 8,325,052 (GRCm39) missense probably damaging 1.00
R6213:Nipbl UTSW 15 8,364,390 (GRCm39) missense probably damaging 1.00
R6216:Nipbl UTSW 15 8,347,867 (GRCm39) missense probably damaging 0.99
R6236:Nipbl UTSW 15 8,354,064 (GRCm39) missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R6427:Nipbl UTSW 15 8,381,049 (GRCm39) missense probably benign
R6707:Nipbl UTSW 15 8,354,043 (GRCm39) missense probably benign 0.01
R6731:Nipbl UTSW 15 8,352,074 (GRCm39) missense probably damaging 1.00
R6921:Nipbl UTSW 15 8,332,969 (GRCm39) missense probably benign 0.28
R7239:Nipbl UTSW 15 8,321,619 (GRCm39) critical splice donor site probably null
R7346:Nipbl UTSW 15 8,373,090 (GRCm39) missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8,359,779 (GRCm39) missense probably benign 0.01
R7486:Nipbl UTSW 15 8,325,120 (GRCm39) missense probably benign 0.25
R7598:Nipbl UTSW 15 8,372,977 (GRCm39) missense probably benign 0.24
R7609:Nipbl UTSW 15 8,335,356 (GRCm39) missense probably benign 0.27
R7674:Nipbl UTSW 15 8,322,585 (GRCm39) missense probably benign 0.15
R7706:Nipbl UTSW 15 8,381,010 (GRCm39) missense probably benign 0.01
R7760:Nipbl UTSW 15 8,388,186 (GRCm39) missense probably damaging 1.00
R7766:Nipbl UTSW 15 8,326,333 (GRCm39) missense probably benign 0.45
R7825:Nipbl UTSW 15 8,320,971 (GRCm39) missense probably damaging 1.00
R7862:Nipbl UTSW 15 8,355,236 (GRCm39) missense probably benign 0.06
R7958:Nipbl UTSW 15 8,340,742 (GRCm39) missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8,340,734 (GRCm39) missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8,388,696 (GRCm39) missense probably benign 0.22
R8355:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8441:Nipbl UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R8455:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8717:Nipbl UTSW 15 8,368,225 (GRCm39) missense probably benign
R8739:Nipbl UTSW 15 8,332,904 (GRCm39) missense probably benign 0.08
R8854:Nipbl UTSW 15 8,330,210 (GRCm39) missense probably damaging 1.00
R8887:Nipbl UTSW 15 8,391,271 (GRCm39) missense probably damaging 1.00
R8942:Nipbl UTSW 15 8,381,104 (GRCm39) missense probably benign
R8991:Nipbl UTSW 15 8,320,997 (GRCm39) missense probably damaging 1.00
R9008:Nipbl UTSW 15 8,356,608 (GRCm39) missense probably damaging 1.00
R9070:Nipbl UTSW 15 8,368,215 (GRCm39) missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8,380,340 (GRCm39) missense probably benign 0.00
R9622:Nipbl UTSW 15 8,366,373 (GRCm39) missense probably benign 0.27
R9778:Nipbl UTSW 15 8,321,032 (GRCm39) missense probably benign 0.10
RF020:Nipbl UTSW 15 8,388,418 (GRCm39) missense probably damaging 0.98
X0022:Nipbl UTSW 15 8,381,199 (GRCm39) missense probably benign 0.05
X0027:Nipbl UTSW 15 8,353,021 (GRCm39) missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8,337,366 (GRCm39) missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8,368,183 (GRCm39) missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8,368,164 (GRCm39) critical splice donor site probably null
Z1177:Nipbl UTSW 15 8,366,436 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCGCTCCCTTTCAATGG -3'
(R):5'- TTAGCTCTCCAACCAAGGACTC -3'

Sequencing Primer
(F):5'- TGCCAACGCGTCCAATTCG -3'
(R):5'- GGACTCCACTAAACTTACATTAAGAC -3'
Posted On 2016-11-08