Mutagenetix > Incidental Mutation

Incidental Mutation 'R5644:Rai14'

441009

Institutional Source

Beutler Lab

Gene Symbol

Rai14

Ensembl Gene

ENSMUSG00000022246

Gene Name

retinoic acid induced 14

Synonyms

1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg

MMRRC Submission

043292-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.515) question?

Stock #

R5644 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10568969-10714624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10593051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 169 (H169L)

Ref Sequence

ENSEMBL: ENSMUSP00000126325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]

AlphaFold

Q9EP71

Predicted Effect

probably benign
Transcript: ENSMUST00000090339
AA Change: H169L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: H169L

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000169385
AA Change: H169L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: H169L

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226530

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226737

Predicted Effect

probably benign
Transcript: ENSMUST00000227506
AA Change: H169L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

Meta Mutation Damage Score

0.0937

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg6	A	T	10: 14,432,934	D805E	probably damaging	Het
Adrb2	A	T	18: 62,178,682	N357K	probably benign	Het
Ahnak	A	G	19: 9,010,657	K3102E	possibly damaging	Het
Alkal2	T	A	12: 30,884,890	L36Q	probably damaging	Het
Alkbh8	G	T	9: 3,385,384	V559F	probably damaging	Het
Apba2	A	G	7: 64,715,511	T346A	probably benign	Het
Arhgap10	C	T	8: 77,411,055	M302I	probably benign	Het
Asah1	G	T	8: 41,360,295	T27K	possibly damaging	Het
Bag2	A	G	1: 33,746,953	V96A	probably damaging	Het
Bicd1	C	T	6: 149,520,403	A874V	probably damaging	Het
C4b	T	C	17: 34,742,417	I189M	probably benign	Het
Cacna1a	A	G	8: 84,462,777	Y119C	probably damaging	Het
Calcr	A	G	6: 3,708,538	I216T	probably damaging	Het
Ccar1	T	C	10: 62,771,978	N302S	probably benign	Het
Ccdc93	A	G	1: 121,483,336	H446R	probably benign	Het
Cct6b	A	T	11: 82,722,455	L420Q	probably benign	Het
Cemip	T	C	7: 83,989,184	T273A	probably benign	Het
Cep128	A	T	12: 91,348,851	I87K	probably damaging	Het
Cfap221	A	G	1: 119,932,802	L698P	probably damaging	Het
Cfap43	T	A	19: 47,795,675	N473I	possibly damaging	Het
Clec12b	T	A	6: 129,379,960	I172L	probably benign	Het
Cntnap5b	A	C	1: 100,383,601	E606D	probably benign	Het
Cyp2c67	A	C	19: 39,615,694	V406G	possibly damaging	Het
Dhx57	T	C	17: 80,238,873	I1308V	possibly damaging	Het
Dnah7a	A	T	1: 53,540,979	M1599K	probably benign	Het
Dnajc21	A	T	15: 10,461,915	D133E	probably benign	Het
Dpp8	G	A	9: 65,045,735	W231*	probably null	Het
Dvl3	T	A	16: 20,526,276	I353N	probably damaging	Het
Fgd6	T	A	10: 94,134,050	I1187N	possibly damaging	Het
Fn1	A	T	1: 71,627,250	Y875N	probably damaging	Het
Gaa	T	A	11: 119,280,535	M671K	possibly damaging	Het
Gm11939	T	C	11: 99,559,312	D52G	probably damaging	Het
Gm14403	A	T	2: 177,507,261	H50L	possibly damaging	Het
Gpam	A	T	19: 55,088,899	D153E	probably benign	Het
Gzma	T	C	13: 113,098,260	T66A	probably damaging	Het
Hnmt	A	T	2: 24,014,239	W137R	probably damaging	Het
Hsd17b7	A	T	1: 169,955,948	V297D	probably damaging	Het
Ighv1-85	A	T	12: 116,000,060	S107T	possibly damaging	Het
Kif12	T	A	4: 63,165,893	Q624L	possibly damaging	Het
Kif1b	T	C	4: 149,238,482	D660G	probably damaging	Het
Klf13	T	C	7: 63,891,560		probably benign	Het
Klhl41	A	G	2: 69,670,471	Y92C	probably damaging	Het
Klrc2	A	T	6: 129,656,457	C186S	probably damaging	Het
Lao1	T	A	4: 118,965,236		probably null	Het
Lmo7	A	G	14: 101,929,336		probably benign	Het
Lyst	A	T	13: 13,637,496	Q831L	possibly damaging	Het
Lzts1	A	G	8: 69,139,077	S140P	possibly damaging	Het
Man2b1	T	A	8: 85,094,210	I679N	possibly damaging	Het
Mgat5b	T	A	11: 116,973,400	V464E	probably damaging	Het
Mrgprb5	G	A	7: 48,168,207	T260I	probably benign	Het
Mybpc2	T	C	7: 44,507,053	T825A	probably benign	Het
Mycbp2	T	A	14: 103,287,334	K597I	probably damaging	Het
Naalad2	G	T	9: 18,334,931	N568K	possibly damaging	Het
Neurl1a	A	G	19: 47,179,477	N4S	probably benign	Het
Nfx1	T	C	4: 40,984,973	W366R	probably null	Het
Nipbl	C	T	15: 8,358,907	V410I	probably benign	Het
Nlrp9a	A	T	7: 26,558,568	H537L	possibly damaging	Het
Nxpe4	A	G	9: 48,392,750	N46D	probably benign	Het
Olfr1037	T	C	2: 86,085,159	N206S	probably damaging	Het
Olfr116	T	A	17: 37,624,432	I68F	probably benign	Het
Olfr1188	T	A	2: 88,559,505	M1K	probably null	Het
Olfr1313	A	T	2: 112,071,668	M305K	probably benign	Het
Olfr1443	A	T	19: 12,680,972	Y288F	probably damaging	Het
Olfr290	C	A	7: 84,916,119	F113L	probably benign	Het
Olfr482	A	T	7: 108,094,804	Y255*	probably null	Het
Olfr484	A	G	7: 108,124,651	F204S	probably benign	Het
Olfr791	A	T	10: 129,527,103	N292I	probably damaging	Het
Olfr813	T	A	10: 129,857,427	V303E	probably benign	Het
P2ry12	A	T	3: 59,218,095	M53K	possibly damaging	Het
Pcca	G	A	14: 122,887,069	C684Y	probably damaging	Het
Pdzd7	A	G	19: 45,040,180	S175P	probably benign	Het
Pgbd1	A	G	13: 21,423,152	C291R	probably damaging	Het
Plekhg5	T	C	4: 152,104,340	V200A	probably benign	Het
Pola2	A	G	19: 5,961,170	V42A	probably benign	Het
Pramef25	C	T	4: 143,948,804	G484D	probably benign	Het
Prkcd	C	A	14: 30,607,413	K23N	probably benign	Het
Ptdss1	T	C	13: 66,972,540	F267L	probably damaging	Het
Rad54l	C	T	4: 116,098,947	S561N	probably benign	Het
Rfc3	C	T	5: 151,649,979	V40I	probably benign	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Rtl1	C	T	12: 109,591,579	M1275I	probably benign	Het
Ryr2	C	A	13: 11,595,582	E4119D	probably damaging	Het
Senp7	T	C	16: 56,184,149		silent	Het
Sfmbt2	A	T	2: 10,568,373	I571F	probably damaging	Het
Sit1	T	A	4: 43,483,562	T8S	probably benign	Het
Slc22a30	T	C	19: 8,404,616	H97R	possibly damaging	Het
Slco1a5	A	C	6: 142,237,594		probably null	Het
Smc6	T	A	12: 11,289,994	N434K	probably benign	Het
Snap91	G	T	9: 86,790,153		probably null	Het
Srsf10	T	C	4: 135,863,820	S194P	possibly damaging	Het
St14	T	C	9: 31,106,510	M205V	probably benign	Het
Syndig1	A	T	2: 149,899,508	I5F	possibly damaging	Het
Tbrg1	T	C	9: 37,649,413	D389G	probably benign	Het
Tcaf2	G	A	6: 42,642,773	R107C	possibly damaging	Het
Tpmt	T	A	13: 47,028,959	D163V	probably benign	Het
Trim15	T	C	17: 36,866,821	E94G	probably damaging	Het
Trit1	T	C	4: 123,049,172	I279T	probably damaging	Het
Trpm8	T	A	1: 88,359,739	F815I	possibly damaging	Het
Ttn	T	A	2: 76,938,523	T2856S	probably damaging	Het
Ugdh	A	T	5: 65,416,861	D446E	probably benign	Het
Unc5c	C	T	3: 141,678,125	A88V	probably damaging	Het
Vmn1r43	T	C	6: 89,870,372	N44S	probably damaging	Het
Vmn2r120	T	A	17: 57,524,977	M271L	probably benign	Het
Wdr74	T	A	19: 8,737,876	V133E	probably damaging	Het
Zfp607b	T	C	7: 27,703,769	L550P	probably damaging	Het

Other mutations in Rai14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Rai14	APN	15	10599711	splice site	probably benign
IGL01625:Rai14	APN	15	10572374	missense	probably benign	0.30
IGL01925:Rai14	APN	15	10595862	missense	possibly damaging	0.88
IGL02053:Rai14	APN	15	10633156	missense	probably benign	0.00
IGL02531:Rai14	APN	15	10574782	missense	probably damaging	1.00
IGL02748:Rai14	APN	15	10589335	missense	probably benign	0.14
IGL02945:Rai14	APN	15	10574709	missense	probably benign	0.00
PIT4618001:Rai14	UTSW	15	10575156	missense	probably damaging	1.00
R1400:Rai14	UTSW	15	10571548	missense	probably damaging	0.98
R1583:Rai14	UTSW	15	10587916	missense	probably damaging	1.00
R1686:Rai14	UTSW	15	10592196	missense	probably damaging	0.98
R1721:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1867:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1868:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1998:Rai14	UTSW	15	10594981	splice site	probably null
R2118:Rai14	UTSW	15	10575166	missense	probably benign	0.00
R3161:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R4049:Rai14	UTSW	15	10592212	missense	probably benign	0.30
R4611:Rai14	UTSW	15	10592138	missense	probably damaging	1.00
R4760:Rai14	UTSW	15	10575690	missense	possibly damaging	0.60
R4863:Rai14	UTSW	15	10572470	missense	probably damaging	0.99
R5022:Rai14	UTSW	15	10574506	missense	probably damaging	0.96
R5110:Rai14	UTSW	15	10690410	start gained	probably benign
R5410:Rai14	UTSW	15	10574938	missense	probably damaging	1.00
R5643:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5681:Rai14	UTSW	15	10575120	missense	probably damaging	1.00
R5934:Rai14	UTSW	15	10575159	missense	probably damaging	0.98
R6333:Rai14	UTSW	15	10574936	nonsense	probably null
R6338:Rai14	UTSW	15	10574976	missense	probably damaging	1.00
R6864:Rai14	UTSW	15	10633168	missense	possibly damaging	0.95
R7015:Rai14	UTSW	15	10589315	nonsense	probably null
R7155:Rai14	UTSW	15	10595003	missense	possibly damaging	0.53
R7480:Rai14	UTSW	15	10571536	missense	probably benign	0.02
R7574:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10574828	missense	probably benign
R7578:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7597:Rai14	UTSW	15	10574851	missense	possibly damaging	0.94
R7658:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7779:Rai14	UTSW	15	10593026	missense	probably damaging	1.00
R7946:Rai14	UTSW	15	10574201	splice site	probably null
R8171:Rai14	UTSW	15	10633163	missense	probably damaging	1.00
R8195:Rai14	UTSW	15	10575216	missense	probably benign
R8471:Rai14	UTSW	15	10575159	missense	probably benign	0.01
R8485:Rai14	UTSW	15	10575036	missense	probably damaging	1.00
R9075:Rai14	UTSW	15	10589317	missense	probably damaging	1.00
R9287:Rai14	UTSW	15	10592118	missense	probably benign	0.14
R9502:Rai14	UTSW	15	10587861	missense	possibly damaging	0.50
R9603:Rai14	UTSW	15	10595030	nonsense	probably null
R9665:Rai14	UTSW	15	10574717	missense	probably damaging	1.00
R9767:Rai14	UTSW	15	10610041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCTGCCCATGGAGATCTGG -3'
(R):5'- CAAGTGTAATGGTGGCCCTAAGG -3'

Sequencing Primer
(F):5'- GACCCTCAATTACCAGGA -3'
(R):5'- CCTAAGGGGGCCTAGAATATCAC -3'

Posted On

2016-11-08