Mutagenetix > Incidental Mutation

Incidental Mutation 'R5644:Ahnak'

441022

Institutional Source

Beutler Lab

Gene Symbol

Ahnak

Ensembl Gene

ENSMUSG00000069833

Gene Name

AHNAK nucleoprotein (desmoyokin)

Synonyms

1110004P15Rik, 2310047C17Rik, DY6

MMRRC Submission

043292-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.317) question?

Stock #

R5644 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8989284-9076919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9010657 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 3102 (K3102E)

Ref Sequence

ENSEMBL: ENSMUSP00000090633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000092955

SMART Domains

Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092956
AA Change: K3102E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: K3102E

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART
internal_repeat_2	163	1515	5.22e-182	PROSPERO
internal_repeat_1	224	2314	N/A	PROSPERO
internal_repeat_2	1532	3028	5.22e-182	PROSPERO
internal_repeat_1	2660	5095	N/A	PROSPERO
low complexity region	5336	5353	N/A	INTRINSIC
low complexity region	5493	5504	N/A	INTRINSIC
low complexity region	5580	5600	N/A	INTRINSIC
low complexity region	5620	5636	N/A	INTRINSIC

Meta Mutation Damage Score

0.0810

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg6	A	T	10: 14,432,934	D805E	probably damaging	Het
Adrb2	A	T	18: 62,178,682	N357K	probably benign	Het
Alkal2	T	A	12: 30,884,890	L36Q	probably damaging	Het
Alkbh8	G	T	9: 3,385,384	V559F	probably damaging	Het
Apba2	A	G	7: 64,715,511	T346A	probably benign	Het
Arhgap10	C	T	8: 77,411,055	M302I	probably benign	Het
Asah1	G	T	8: 41,360,295	T27K	possibly damaging	Het
Bag2	A	G	1: 33,746,953	V96A	probably damaging	Het
Bicd1	C	T	6: 149,520,403	A874V	probably damaging	Het
C4b	T	C	17: 34,742,417	I189M	probably benign	Het
Cacna1a	A	G	8: 84,462,777	Y119C	probably damaging	Het
Calcr	A	G	6: 3,708,538	I216T	probably damaging	Het
Ccar1	T	C	10: 62,771,978	N302S	probably benign	Het
Ccdc93	A	G	1: 121,483,336	H446R	probably benign	Het
Cct6b	A	T	11: 82,722,455	L420Q	probably benign	Het
Cemip	T	C	7: 83,989,184	T273A	probably benign	Het
Cep128	A	T	12: 91,348,851	I87K	probably damaging	Het
Cfap221	A	G	1: 119,932,802	L698P	probably damaging	Het
Cfap43	T	A	19: 47,795,675	N473I	possibly damaging	Het
Clec12b	T	A	6: 129,379,960	I172L	probably benign	Het
Cntnap5b	A	C	1: 100,383,601	E606D	probably benign	Het
Cyp2c67	A	C	19: 39,615,694	V406G	possibly damaging	Het
Dhx57	T	C	17: 80,238,873	I1308V	possibly damaging	Het
Dnah7a	A	T	1: 53,540,979	M1599K	probably benign	Het
Dnajc21	A	T	15: 10,461,915	D133E	probably benign	Het
Dpp8	G	A	9: 65,045,735	W231*	probably null	Het
Dvl3	T	A	16: 20,526,276	I353N	probably damaging	Het
Fgd6	T	A	10: 94,134,050	I1187N	possibly damaging	Het
Fn1	A	T	1: 71,627,250	Y875N	probably damaging	Het
Gaa	T	A	11: 119,280,535	M671K	possibly damaging	Het
Gm11939	T	C	11: 99,559,312	D52G	probably damaging	Het
Gm14403	A	T	2: 177,507,261	H50L	possibly damaging	Het
Gpam	A	T	19: 55,088,899	D153E	probably benign	Het
Gzma	T	C	13: 113,098,260	T66A	probably damaging	Het
Hnmt	A	T	2: 24,014,239	W137R	probably damaging	Het
Hsd17b7	A	T	1: 169,955,948	V297D	probably damaging	Het
Ighv1-85	A	T	12: 116,000,060	S107T	possibly damaging	Het
Kif12	T	A	4: 63,165,893	Q624L	possibly damaging	Het
Kif1b	T	C	4: 149,238,482	D660G	probably damaging	Het
Klf13	T	C	7: 63,891,560		probably benign	Het
Klhl41	A	G	2: 69,670,471	Y92C	probably damaging	Het
Klrc2	A	T	6: 129,656,457	C186S	probably damaging	Het
Lao1	T	A	4: 118,965,236		probably null	Het
Lmo7	A	G	14: 101,929,336		probably benign	Het
Lyst	A	T	13: 13,637,496	Q831L	possibly damaging	Het
Lzts1	A	G	8: 69,139,077	S140P	possibly damaging	Het
Man2b1	T	A	8: 85,094,210	I679N	possibly damaging	Het
Mgat5b	T	A	11: 116,973,400	V464E	probably damaging	Het
Mrgprb5	G	A	7: 48,168,207	T260I	probably benign	Het
Mybpc2	T	C	7: 44,507,053	T825A	probably benign	Het
Mycbp2	T	A	14: 103,287,334	K597I	probably damaging	Het
Naalad2	G	T	9: 18,334,931	N568K	possibly damaging	Het
Neurl1a	A	G	19: 47,179,477	N4S	probably benign	Het
Nfx1	T	C	4: 40,984,973	W366R	probably null	Het
Nipbl	C	T	15: 8,358,907	V410I	probably benign	Het
Nlrp9a	A	T	7: 26,558,568	H537L	possibly damaging	Het
Nxpe4	A	G	9: 48,392,750	N46D	probably benign	Het
Olfr1037	T	C	2: 86,085,159	N206S	probably damaging	Het
Olfr116	T	A	17: 37,624,432	I68F	probably benign	Het
Olfr1188	T	A	2: 88,559,505	M1K	probably null	Het
Olfr1313	A	T	2: 112,071,668	M305K	probably benign	Het
Olfr1443	A	T	19: 12,680,972	Y288F	probably damaging	Het
Olfr290	C	A	7: 84,916,119	F113L	probably benign	Het
Olfr482	A	T	7: 108,094,804	Y255*	probably null	Het
Olfr484	A	G	7: 108,124,651	F204S	probably benign	Het
Olfr791	A	T	10: 129,527,103	N292I	probably damaging	Het
Olfr813	T	A	10: 129,857,427	V303E	probably benign	Het
P2ry12	A	T	3: 59,218,095	M53K	possibly damaging	Het
Pcca	G	A	14: 122,887,069	C684Y	probably damaging	Het
Pdzd7	A	G	19: 45,040,180	S175P	probably benign	Het
Pgbd1	A	G	13: 21,423,152	C291R	probably damaging	Het
Plekhg5	T	C	4: 152,104,340	V200A	probably benign	Het
Pola2	A	G	19: 5,961,170	V42A	probably benign	Het
Pramef25	C	T	4: 143,948,804	G484D	probably benign	Het
Prkcd	C	A	14: 30,607,413	K23N	probably benign	Het
Ptdss1	T	C	13: 66,972,540	F267L	probably damaging	Het
Rad54l	C	T	4: 116,098,947	S561N	probably benign	Het
Rai14	T	A	15: 10,593,051	H169L	probably benign	Het
Rfc3	C	T	5: 151,649,979	V40I	probably benign	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Rtl1	C	T	12: 109,591,579	M1275I	probably benign	Het
Ryr2	C	A	13: 11,595,582	E4119D	probably damaging	Het
Senp7	T	C	16: 56,184,149		silent	Het
Sfmbt2	A	T	2: 10,568,373	I571F	probably damaging	Het
Sit1	T	A	4: 43,483,562	T8S	probably benign	Het
Slc22a30	T	C	19: 8,404,616	H97R	possibly damaging	Het
Slco1a5	A	C	6: 142,237,594		probably null	Het
Smc6	T	A	12: 11,289,994	N434K	probably benign	Het
Snap91	G	T	9: 86,790,153		probably null	Het
Srsf10	T	C	4: 135,863,820	S194P	possibly damaging	Het
St14	T	C	9: 31,106,510	M205V	probably benign	Het
Syndig1	A	T	2: 149,899,508	I5F	possibly damaging	Het
Tbrg1	T	C	9: 37,649,413	D389G	probably benign	Het
Tcaf2	G	A	6: 42,642,773	R107C	possibly damaging	Het
Tpmt	T	A	13: 47,028,959	D163V	probably benign	Het
Trim15	T	C	17: 36,866,821	E94G	probably damaging	Het
Trit1	T	C	4: 123,049,172	I279T	probably damaging	Het
Trpm8	T	A	1: 88,359,739	F815I	possibly damaging	Het
Ttn	T	A	2: 76,938,523	T2856S	probably damaging	Het
Ugdh	A	T	5: 65,416,861	D446E	probably benign	Het
Unc5c	C	T	3: 141,678,125	A88V	probably damaging	Het
Vmn1r43	T	C	6: 89,870,372	N44S	probably damaging	Het
Vmn2r120	T	A	17: 57,524,977	M271L	probably benign	Het
Wdr74	T	A	19: 8,737,876	V133E	probably damaging	Het
Zfp607b	T	C	7: 27,703,769	L550P	probably damaging	Het

Other mutations in Ahnak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Ahnak	APN	19	9007223	missense	probably damaging	0.99
IGL00509:Ahnak	APN	19	9009951	missense	possibly damaging	0.94
IGL00539:Ahnak	APN	19	9007908	missense	possibly damaging	0.50
IGL00558:Ahnak	APN	19	9004307	missense	possibly damaging	0.93
IGL00567:Ahnak	APN	19	9013383	missense	probably benign	0.24
IGL00706:Ahnak	APN	19	9013730	nonsense	probably null
IGL00807:Ahnak	APN	19	9008522	missense	possibly damaging	0.92
IGL00870:Ahnak	APN	19	9013698	missense	probably damaging	1.00
IGL01101:Ahnak	APN	19	9012887	intron	probably benign
IGL01118:Ahnak	APN	19	9012578	missense	probably damaging	1.00
IGL01288:Ahnak	APN	19	9002494	missense	possibly damaging	0.94
IGL01324:Ahnak	APN	19	9003032	missense	probably damaging	1.00
IGL01341:Ahnak	APN	19	9011703	missense	probably benign
IGL01541:Ahnak	APN	19	9007879	missense	possibly damaging	0.95
IGL01580:Ahnak	APN	19	9002839	missense	probably benign	0.02
IGL01595:Ahnak	APN	19	9003501	nonsense	probably null
IGL01746:Ahnak	APN	19	9004912	missense	possibly damaging	0.89
IGL01766:Ahnak	APN	19	9000118	missense	unknown
IGL01821:Ahnak	APN	19	9012118	missense	probably benign
IGL01913:Ahnak	APN	19	9006064	nonsense	probably null
IGL01934:Ahnak	APN	19	9002657	missense	probably damaging	1.00
IGL01940:Ahnak	APN	19	9006557	missense	probably benign	0.14
IGL01958:Ahnak	APN	19	9014909	missense	possibly damaging	0.59
IGL02145:Ahnak	APN	19	9002855	missense	probably benign	0.11
IGL02246:Ahnak	APN	19	9008268	missense	probably damaging	1.00
IGL02282:Ahnak	APN	19	9005987	missense	probably damaging	1.00
IGL02428:Ahnak	APN	19	9014833	missense	possibly damaging	0.83
IGL02442:Ahnak	APN	19	9004016	missense	probably damaging	1.00
IGL02474:Ahnak	APN	19	9004933	missense	probably benign	0.13
IGL02483:Ahnak	APN	19	9003308	missense	probably benign	0.01
IGL02616:Ahnak	APN	19	9005627	missense	probably benign	0.03
IGL02630:Ahnak	APN	19	9012077	missense	probably damaging	1.00
IGL02690:Ahnak	APN	19	9012584	nonsense	probably null
IGL02717:Ahnak	APN	19	9002387	missense	probably benign	0.00
IGL02721:Ahnak	APN	19	9009707	missense	probably benign	0.07
IGL02737:Ahnak	APN	19	9004593	missense	probably benign	0.17
IGL02850:Ahnak	APN	19	9002596	missense	probably benign	0.00
IGL03071:Ahnak	APN	19	9011918	missense	possibly damaging	0.63
IGL03072:Ahnak	APN	19	9006508	missense	probably benign	0.11
IGL03094:Ahnak	APN	19	9003547	missense	possibly damaging	0.64
IGL03140:Ahnak	APN	19	9005212	intron	probably benign
IGL03176:Ahnak	APN	19	9008166	missense	possibly damaging	0.56
IGL03176:Ahnak	APN	19	9002449	missense	probably damaging	1.00
IGL03189:Ahnak	APN	19	9011239	missense	possibly damaging	0.65
IGL03357:Ahnak	APN	19	9009325	intron	probably benign
IGL03371:Ahnak	APN	19	9004228	missense	possibly damaging	0.91
Eskimo	UTSW	19	9009574	missense	probably benign	0.31
Nanook	UTSW	19	9003231	missense	probably benign	0.42
Netsilik	UTSW	19	9002321	missense	probably benign	0.00
IGL03097:Ahnak	UTSW	19	9002387	missense	probably benign	0.00
PIT4403001:Ahnak	UTSW	19	9006176	missense	possibly damaging	0.87
R0054:Ahnak	UTSW	19	9012056	missense	probably damaging	1.00
R0094:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R0110:Ahnak	UTSW	19	9018232	nonsense	probably null
R0141:Ahnak	UTSW	19	9006680	missense	probably damaging	1.00
R0166:Ahnak	UTSW	19	9005725	missense	probably damaging	1.00
R0309:Ahnak	UTSW	19	9002495	missense	probably damaging	1.00
R0368:Ahnak	UTSW	19	9008350	nonsense	probably null
R0386:Ahnak	UTSW	19	9011144	missense	possibly damaging	0.94
R0401:Ahnak	UTSW	19	9015116	missense	probably benign	0.24
R0415:Ahnak	UTSW	19	9012871	intron	probably benign
R0463:Ahnak	UTSW	19	9009407	intron	probably benign
R0469:Ahnak	UTSW	19	9018232	nonsense	probably null
R0470:Ahnak	UTSW	19	9008967	missense	probably benign	0.29
R0487:Ahnak	UTSW	19	9007151	missense	probably benign	0.00
R0487:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R0499:Ahnak	UTSW	19	9000264	splice site	probably benign
R0506:Ahnak	UTSW	19	9009128	missense	probably damaging	1.00
R0510:Ahnak	UTSW	19	9018232	nonsense	probably null
R0557:Ahnak	UTSW	19	9001944	missense	probably benign	0.10
R0570:Ahnak	UTSW	19	9013698	missense	probably damaging	1.00
R0610:Ahnak	UTSW	19	9007878	missense	probably benign	0.08
R0646:Ahnak	UTSW	19	9013402	nonsense	probably null
R0659:Ahnak	UTSW	19	9015002	missense	possibly damaging	0.60
R0791:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0792:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0840:Ahnak	UTSW	19	9005063	missense	probably damaging	1.00
R0847:Ahnak	UTSW	19	9006433	nonsense	probably null
R0941:Ahnak	UTSW	19	9009914	missense	probably damaging	1.00
R0962:Ahnak	UTSW	19	9012848	intron	probably benign
R1017:Ahnak	UTSW	19	9010543	missense	probably damaging	0.99
R1037:Ahnak	UTSW	19	9007618	missense	probably benign	0.27
R1085:Ahnak	UTSW	19	9013125	missense	possibly damaging	0.50
R1113:Ahnak	UTSW	19	9005620	missense	probably benign	0.29
R1140:Ahnak	UTSW	19	9004245	missense	probably damaging	1.00
R1158:Ahnak	UTSW	19	9013926	missense	probably benign	0.00
R1218:Ahnak	UTSW	19	9015619	missense	probably damaging	1.00
R1225:Ahnak	UTSW	19	9002883	missense	probably damaging	1.00
R1245:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R1421:Ahnak	UTSW	19	9015631	missense	possibly damaging	0.95
R1447:Ahnak	UTSW	19	9007082	missense	probably damaging	0.98
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1471:Ahnak	UTSW	19	9012932	intron	probably benign
R1507:Ahnak	UTSW	19	9010077	missense	probably damaging	1.00
R1521:Ahnak	UTSW	19	9004728	missense	probably benign	0.11
R1568:Ahnak	UTSW	19	9002375	missense	probably damaging	0.98
R1569:Ahnak	UTSW	19	9004094	missense	possibly damaging	0.78
R1616:Ahnak	UTSW	19	9008987	missense	possibly damaging	0.94
R1638:Ahnak	UTSW	19	9009449	missense	probably benign	0.01
R1680:Ahnak	UTSW	19	9009963	missense	probably benign	0.05
R1713:Ahnak	UTSW	19	9011809	missense	possibly damaging	0.95
R1722:Ahnak	UTSW	19	9010655	missense	probably damaging	0.99
R1771:Ahnak	UTSW	19	9013753	missense	probably benign	0.24
R1795:Ahnak	UTSW	19	9002438	missense	possibly damaging	0.79
R1823:Ahnak	UTSW	19	9004905	missense	probably damaging	0.99
R1842:Ahnak	UTSW	19	9005867	missense	probably damaging	0.99
R1854:Ahnak	UTSW	19	9013832	missense	possibly damaging	0.61
R1856:Ahnak	UTSW	19	9002048	missense	possibly damaging	0.86
R1886:Ahnak	UTSW	19	9015979	missense	probably damaging	0.98
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1912:Ahnak	UTSW	19	9017881	missense	probably damaging	1.00
R1913:Ahnak	UTSW	19	9007922	missense	probably damaging	0.99
R1942:Ahnak	UTSW	19	9015083	missense	probably damaging	0.98
R1987:Ahnak	UTSW	19	9015251	missense	probably damaging	1.00
R2006:Ahnak	UTSW	19	9007075	missense	probably damaging	1.00
R2013:Ahnak	UTSW	19	9014573	missense	probably damaging	0.98
R2014:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R2047:Ahnak	UTSW	19	9014300	missense	possibly damaging	0.67
R2048:Ahnak	UTSW	19	9007056	missense	probably damaging	0.99
R2060:Ahnak	UTSW	19	9008041	missense	probably benign	0.08
R2083:Ahnak	UTSW	19	9011557	missense	probably damaging	1.00
R2157:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R2167:Ahnak	UTSW	19	9011494	nonsense	probably null
R2208:Ahnak	UTSW	19	9017732	missense	probably benign	0.00
R2224:Ahnak	UTSW	19	9012991	intron	probably benign
R2268:Ahnak	UTSW	19	9010574	missense	possibly damaging	0.66
R2420:Ahnak	UTSW	19	9009256	missense	possibly damaging	0.89
R2426:Ahnak	UTSW	19	9002851	missense	possibly damaging	0.81
R2910:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2911:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2981:Ahnak	UTSW	19	9000148	missense	probably damaging	0.97
R3151:Ahnak	UTSW	19	9009944	missense	probably benign	0.12
R3155:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R3422:Ahnak	UTSW	19	9005708	missense	probably benign	0.39
R3422:Ahnak	UTSW	19	9006752	missense	probably benign	0.05
R3430:Ahnak	UTSW	19	9006958	missense	probably benign	0.42
R3433:Ahnak	UTSW	19	9009994	missense	probably benign	0.01
R3711:Ahnak	UTSW	19	9007898	missense	probably benign
R3723:Ahnak	UTSW	19	9016853	missense	possibly damaging	0.79
R3775:Ahnak	UTSW	19	9009023	missense	possibly damaging	0.91
R3858:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3859:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3922:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3924:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3926:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R4026:Ahnak	UTSW	19	9011299	missense	probably damaging	0.97
R4051:Ahnak	UTSW	19	9014327	missense	probably damaging	1.00
R4209:Ahnak	UTSW	19	9002600	missense	probably damaging	1.00
R4234:Ahnak	UTSW	19	9000786	nonsense	probably null
R4237:Ahnak	UTSW	19	9001783	missense	probably benign	0.02
R4285:Ahnak	UTSW	19	9016839	nonsense	probably null
R4331:Ahnak	UTSW	19	9015820	missense	probably damaging	1.00
R4342:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R4430:Ahnak	UTSW	19	9003040	missense	probably benign	0.00
R4554:Ahnak	UTSW	19	9014930	missense	probably damaging	1.00
R4602:Ahnak	UTSW	19	9010825	missense	possibly damaging	0.66
R4612:Ahnak	UTSW	19	9003724	missense	probably benign	0.44
R4655:Ahnak	UTSW	19	9008701	missense	probably damaging	1.00
R4656:Ahnak	UTSW	19	9004855	missense	possibly damaging	0.80
R4700:Ahnak	UTSW	19	9004681	missense	probably benign	0.02
R4704:Ahnak	UTSW	19	9012258	intron	probably benign
R4704:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R4705:Ahnak	UTSW	19	9016906	missense	probably benign	0.07
R4707:Ahnak	UTSW	19	9016735	missense	probably benign	0.03
R4732:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4733:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4778:Ahnak	UTSW	19	9011975	missense	possibly damaging	0.79
R4782:Ahnak	UTSW	19	9012499	intron	probably benign
R4832:Ahnak	UTSW	19	9012460	intron	probably benign
R4882:Ahnak	UTSW	19	9005897	missense	probably damaging	0.98
R4884:Ahnak	UTSW	19	9012754	intron	probably benign
R4895:Ahnak	UTSW	19	9017441	missense	probably benign	0.43
R4930:Ahnak	UTSW	19	9010967	missense	possibly damaging	0.79
R4951:Ahnak	UTSW	19	9017835	missense	probably damaging	1.00
R4968:Ahnak	UTSW	19	9015100	missense	probably damaging	1.00
R5026:Ahnak	UTSW	19	9010631	missense	possibly damaging	0.46
R5050:Ahnak	UTSW	19	9012458	intron	probably benign
R5073:Ahnak	UTSW	19	9003231	missense	probably benign	0.42
R5110:Ahnak	UTSW	19	9014759	missense	probably damaging	1.00
R5119:Ahnak	UTSW	19	9013644	missense	probably benign	0.00
R5128:Ahnak	UTSW	19	9017087	missense	probably damaging	1.00
R5139:Ahnak	UTSW	19	9004655	missense	probably damaging	1.00
R5150:Ahnak	UTSW	19	9010904	missense	possibly damaging	0.46
R5151:Ahnak	UTSW	19	9017569	missense	probably benign	0.03
R5165:Ahnak	UTSW	19	9015665	missense	possibly damaging	0.95
R5236:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R5361:Ahnak	UTSW	19	9015341	missense	possibly damaging	0.92
R5366:Ahnak	UTSW	19	9016735	missense	possibly damaging	0.65
R5387:Ahnak	UTSW	19	9003691	missense	probably damaging	1.00
R5396:Ahnak	UTSW	19	9007175	missense	probably damaging	0.99
R5583:Ahnak	UTSW	19	9006917	missense	probably damaging	0.99
R5587:Ahnak	UTSW	19	9009476	missense	possibly damaging	0.88
R5620:Ahnak	UTSW	19	9013094	nonsense	probably null
R5643:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5657:Ahnak	UTSW	19	9014615	missense	probably damaging	0.99
R5688:Ahnak	UTSW	19	9002519	missense	probably benign	0.01
R5702:Ahnak	UTSW	19	9001840	missense	probably damaging	1.00
R5727:Ahnak	UTSW	19	9016747	missense	probably damaging	0.99
R5730:Ahnak	UTSW	19	9010253	missense	possibly damaging	0.81
R5755:Ahnak	UTSW	19	9001732	missense	probably benign	0.06
R5760:Ahnak	UTSW	19	9013562	missense	probably damaging	1.00
R5789:Ahnak	UTSW	19	9002321	missense	probably benign	0.00
R5790:Ahnak	UTSW	19	9015248	missense	probably damaging	0.99
R5795:Ahnak	UTSW	19	9012382	nonsense	probably null
R5808:Ahnak	UTSW	19	9010235	missense	possibly damaging	0.91
R5867:Ahnak	UTSW	19	9010052	missense	probably damaging	0.99
R5878:Ahnak	UTSW	19	9008342	missense	probably damaging	1.00
R5898:Ahnak	UTSW	19	9013767	missense	possibly damaging	0.63
R5898:Ahnak	UTSW	19	9018211	missense	probably damaging	1.00
R5912:Ahnak	UTSW	19	9011903	missense	probably damaging	0.99
R5935:Ahnak	UTSW	19	9015182	missense	possibly damaging	0.91
R5969:Ahnak	UTSW	19	9016585	missense	probably damaging	1.00
R5988:Ahnak	UTSW	19	9009347	intron	probably benign
R6000:Ahnak	UTSW	19	9013111	nonsense	probably null
R6005:Ahnak	UTSW	19	9015161	missense	possibly damaging	0.61
R6101:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6105:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6116:Ahnak	UTSW	19	9012963	intron	probably benign
R6209:Ahnak	UTSW	19	9012566	missense	probably damaging	1.00
R6240:Ahnak	UTSW	19	9013583	missense	probably damaging	1.00
R6255:Ahnak	UTSW	19	9008025	missense	possibly damaging	0.95
R6263:Ahnak	UTSW	19	9018277	missense	probably benign	0.03
R6287:Ahnak	UTSW	19	9015003	missense	probably benign	0.02
R6296:Ahnak	UTSW	19	9003305	missense	probably damaging	0.99
R6315:Ahnak	UTSW	19	9006626	missense	probably damaging	0.99
R6328:Ahnak	UTSW	19	9007148	missense	probably benign	0.11
R6331:Ahnak	UTSW	19	9006625	missense	probably benign	0.18
R6355:Ahnak	UTSW	19	9008762	missense	probably benign	0.02
R6409:Ahnak	UTSW	19	9009574	missense	probably benign	0.31
R6567:Ahnak	UTSW	19	9008806	missense	probably benign	0.27
R6572:Ahnak	UTSW	19	9007976	missense	probably damaging	0.99
R6574:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R6590:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6620:Ahnak	UTSW	19	9015310	missense	possibly damaging	0.95
R6690:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6731:Ahnak	UTSW	19	9011562	missense	possibly damaging	0.85
R6756:Ahnak	UTSW	19	9007561	missense	possibly damaging	0.59
R6846:Ahnak	UTSW	19	9011857	missense	possibly damaging	0.66
R6854:Ahnak	UTSW	19	9015235	missense	probably damaging	1.00
R6857:Ahnak	UTSW	19	9037168	nonsense	probably null
R6863:Ahnak	UTSW	19	9012365	intron	probably benign
R6876:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R6958:Ahnak	UTSW	19	9015215	missense	possibly damaging	0.88
R7126:Ahnak	UTSW	19	9002359	missense	possibly damaging	0.61
R7181:Ahnak	UTSW	19	9013488	missense	probably damaging	1.00
R7183:Ahnak	UTSW	19	9017668	missense	probably damaging	1.00
R7202:Ahnak	UTSW	19	9017799	missense	probably damaging	1.00
R7235:Ahnak	UTSW	19	9012488	missense	unknown
R7241:Ahnak	UTSW	19	9009031	missense	possibly damaging	0.65
R7269:Ahnak	UTSW	19	9006617	missense	probably damaging	1.00
R7311:Ahnak	UTSW	19	9002143	missense	probably benign	0.04
R7311:Ahnak	UTSW	19	9009827	missense	possibly damaging	0.56
R7329:Ahnak	UTSW	19	9001792	missense	probably damaging	0.99
R7339:Ahnak	UTSW	19	9008165	missense	possibly damaging	0.75
R7390:Ahnak	UTSW	19	9003205	missense	probably benign	0.02
R7400:Ahnak	UTSW	19	9014613	missense	probably damaging	0.99
R7444:Ahnak	UTSW	19	9007423	missense	probably benign	0.08
R7483:Ahnak	UTSW	19	9004822	missense	probably damaging	1.00
R7498:Ahnak	UTSW	19	9012019	missense	probably benign	0.14
R7521:Ahnak	UTSW	19	9002351	missense	possibly damaging	0.89
R7522:Ahnak	UTSW	19	9002322	missense	probably benign	0.01
R7552:Ahnak	UTSW	19	9006824	missense	probably benign	0.18
R7563:Ahnak	UTSW	19	9011165	missense	probably damaging	0.99
R7565:Ahnak	UTSW	19	9016156	missense	probably benign	0.05
R7571:Ahnak	UTSW	19	9000786	nonsense	probably null
R7583:Ahnak	UTSW	19	9006093	missense	possibly damaging	0.90
R7600:Ahnak	UTSW	19	9004574	missense	possibly damaging	0.89
R7771:Ahnak	UTSW	19	9015047	missense	probably damaging	0.99
R7787:Ahnak	UTSW	19	9009315	missense	unknown
R7827:Ahnak	UTSW	19	9005344	nonsense	probably null
R7857:Ahnak	UTSW	19	9007468	missense	probably damaging	0.97
R7916:Ahnak	UTSW	19	9005832	missense	possibly damaging	0.66
R7939:Ahnak	UTSW	19	9014084	nonsense	probably null
R7959:Ahnak	UTSW	19	9010649	missense	possibly damaging	0.46
R7962:Ahnak	UTSW	19	9012800	missense	unknown
R7979:Ahnak	UTSW	19	9011432	missense	probably damaging	1.00
R8006:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R8013:Ahnak	UTSW	19	9009335	missense	unknown
R8033:Ahnak	UTSW	19	9003710	missense	probably benign	0.10
R8124:Ahnak	UTSW	19	9007123	missense	probably damaging	0.99
R8125:Ahnak	UTSW	19	9011876	missense	possibly damaging	0.95
R8129:Ahnak	UTSW	19	9000100	start codon destroyed	not run
R8151:Ahnak	UTSW	19	9004679	missense	possibly damaging	0.59
R8190:Ahnak	UTSW	19	9002255	missense	probably benign	0.01
R8221:Ahnak	UTSW	19	9010436	nonsense	probably null
R8241:Ahnak	UTSW	19	9007295	missense	probably benign	0.15
R8244:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8248:Ahnak	UTSW	19	9001946	missense	probably damaging	1.00
R8261:Ahnak	UTSW	19	9005453	missense	probably damaging	1.00
R8330:Ahnak	UTSW	19	9009662	missense	possibly damaging	0.86
R8380:Ahnak	UTSW	19	9017855	missense	probably benign	0.05
R8407:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8409:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8463:Ahnak	UTSW	19	9008749	missense	probably benign	0.07
R8511:Ahnak	UTSW	19	9012355	missense	unknown
R8528:Ahnak	UTSW	19	9007728	missense	probably damaging	1.00
R8549:Ahnak	UTSW	19	9011483	missense	probably damaging	1.00
R8674:Ahnak	UTSW	19	9005996	missense	probably damaging	0.98
R8716:Ahnak	UTSW	19	9009074	missense	probably damaging	1.00
R8722:Ahnak	UTSW	19	9013346	nonsense	probably null
R8751:Ahnak	UTSW	19	9010145	missense	probably damaging	1.00
R8752:Ahnak	UTSW	19	9015537	missense	probably damaging	1.00
R8783:Ahnak	UTSW	19	9011473	missense	probably damaging	1.00
R8844:Ahnak	UTSW	19	9006890	missense	probably damaging	1.00
R8859:Ahnak	UTSW	19	9007203	missense	probably damaging	1.00
R8882:Ahnak	UTSW	19	9000742	missense	probably damaging	1.00
R8907:Ahnak	UTSW	19	9009088	missense	probably benign	0.24
R8938:Ahnak	UTSW	19	9011735	missense	probably benign	0.00
R8975:Ahnak	UTSW	19	9012737	missense	probably damaging	1.00
R8983:Ahnak	UTSW	19	9004113	missense	possibly damaging	0.75
R9017:Ahnak	UTSW	19	9010123	missense	probably damaging	1.00
R9027:Ahnak	UTSW	19	9007253	missense	possibly damaging	0.94
R9081:Ahnak	UTSW	19	9008526	missense	possibly damaging	0.81
R9104:Ahnak	UTSW	19	9010347	missense	probably benign	0.01
R9112:Ahnak	UTSW	19	9009785	missense	probably damaging	0.98
R9145:Ahnak	UTSW	19	9014923	missense	probably benign	0.38
R9189:Ahnak	UTSW	19	9010883	missense	possibly damaging	0.92
R9221:Ahnak	UTSW	19	9012579	missense	probably damaging	1.00
R9261:Ahnak	UTSW	19	9016139	missense	possibly damaging	0.63
R9299:Ahnak	UTSW	19	9012460	intron	probably benign
R9325:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R9337:Ahnak	UTSW	19	9012460	intron	probably benign
R9340:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R9351:Ahnak	UTSW	19	9007868	missense	probably damaging	1.00
R9416:Ahnak	UTSW	19	9012902	missense	unknown
R9462:Ahnak	UTSW	19	9003935	missense	probably damaging	0.96
R9469:Ahnak	UTSW	19	9010861	missense	probably damaging	1.00
R9485:Ahnak	UTSW	19	9002074	missense	probably benign	0.16
R9503:Ahnak	UTSW	19	9010094	missense	probably damaging	1.00
R9524:Ahnak	UTSW	19	9037253	missense
R9534:Ahnak	UTSW	19	9003612	missense	probably benign	0.20
R9598:Ahnak	UTSW	19	9003785	missense	probably benign	0.42
R9611:Ahnak	UTSW	19	9011798	missense	probably damaging	0.99
R9624:Ahnak	UTSW	19	9012482	missense	unknown
R9649:Ahnak	UTSW	19	9008422	nonsense	probably null
R9683:Ahnak	UTSW	19	9007355	missense	possibly damaging	0.94
R9691:Ahnak	UTSW	19	9011726	missense	possibly damaging	0.49
R9712:Ahnak	UTSW	19	9007028	small deletion	probably benign
R9712:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9713:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9715:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9725:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R9725:Ahnak	UTSW	19	9014243	missense	probably damaging	1.00
R9747:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R9798:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
RF007:Ahnak	UTSW	19	9013601	missense	possibly damaging	0.45
X0021:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
X0027:Ahnak	UTSW	19	9012037	missense	probably damaging	1.00
Z1088:Ahnak	UTSW	19	9016082	missense	probably damaging	0.99
Z1176:Ahnak	UTSW	19	9008856	missense	probably damaging	0.97
Z1177:Ahnak	UTSW	19	9017468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGGACCCAAACTGGAG -3'
(R):5'- TCCACTTTGGGTCCTTTGAAG -3'

Sequencing Primer
(F):5'- CTGGAGGGTGACATTAAAGTTCCC -3'
(R):5'- AAATTTGGGCCTGCTGCATC -3'

Posted On

2016-11-08