Mutagenetix > Incidental Mutation

Incidental Mutation 'R5645:Cr2'

441033

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

043293-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R5645 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 195154273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 861 (H861N)

Ref Sequence

ENSEMBL: ENSMUSP00000141538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: H861N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: H861N

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: H564N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: H564N

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193436

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: H861N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: H861N

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

probably damaging
Transcript: ENSMUST00000210219
AA Change: H1237N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	G	9: 108,397,204	I169V	probably damaging	Het
2310007B03Rik	T	C	1: 93,152,946	T413A	probably damaging	Het
4930503B20Rik	C	T	3: 146,650,509	E215K	probably damaging	Het
5830411N06Rik	G	A	7: 140,248,940	V171I	possibly damaging	Het
Abca6	T	C	11: 110,250,408	E29G	probably damaging	Het
Acsm1	A	G	7: 119,640,697	H288R	probably damaging	Het
Adamts12	A	G	15: 11,277,420	T707A	possibly damaging	Het
Adcy2	C	A	13: 68,729,202		probably null	Het
Agbl4	A	T	4: 111,657,330	I513F	possibly damaging	Het
Ak5	A	T	3: 152,656,033	M84K	possibly damaging	Het
Akap1	T	C	11: 88,845,627	T103A	probably benign	Het
Akap9	A	G	5: 4,050,590	T2751A	probably benign	Het
Amer3	A	T	1: 34,588,381	H567L	possibly damaging	Het
Ano6	A	G	15: 95,920,351	Y325C	probably benign	Het
Apba2	A	G	7: 64,695,806	E248G	possibly damaging	Het
Asap2	T	A	12: 21,265,982	V967E	probably damaging	Het
Boc	A	G	16: 44,499,661	V320A	probably damaging	Het
Car13	T	A	3: 14,645,120	Y41N	possibly damaging	Het
Ccdc162	T	C	10: 41,552,356	T1976A	probably benign	Het
Cep295	A	T	9: 15,332,794	H1455Q	probably damaging	Het
Cep295	C	A	9: 15,335,108	S684I	possibly damaging	Het
Cul5	T	C	9: 53,622,943	I630V	probably benign	Het
Cyp2c37	G	A	19: 39,994,152	V145I	probably benign	Het
Dnmt1	G	A	9: 20,922,147	T500M	probably damaging	Het
Fam161a	T	A	11: 23,015,725	I6N	probably damaging	Het
Fam214a	T	A	9: 75,025,679	V976E	probably damaging	Het
Fry	T	C	5: 150,380,867	V574A	probably damaging	Het
Glb1l3	G	T	9: 26,824,826	L553I	probably benign	Het
Gm1123	T	C	9: 99,014,191	D212G	probably benign	Het
Grin2a	T	A	16: 9,992,226	D103V	probably damaging	Het
Heg1	A	G	16: 33,706,963	I98V	probably benign	Het
Hmcn2	C	A	2: 31,420,812	T3356N	possibly damaging	Het
Hpf1	T	G	8: 60,896,800	I154S	possibly damaging	Het
Ifnar2	A	G	16: 91,404,227	D452G	possibly damaging	Het
Ikbkap	T	C	4: 56,776,920	T626A	possibly damaging	Het
Iqcc	A	T	4: 129,616,527	H398Q	possibly damaging	Het
Iqgap3	T	C	3: 88,117,699	I669T	probably damaging	Het
Itgae	A	G	11: 73,129,248	T859A	probably damaging	Het
Kansl1l	T	C	1: 66,801,344	M266V	probably benign	Het
Kbtbd3	A	G	9: 4,331,426	D600G	possibly damaging	Het
Klf13	G	A	7: 63,891,600		probably benign	Het
Kmt2d	A	G	15: 98,844,397		probably benign	Het
Lama1	A	G	17: 67,802,948	D2188G	probably damaging	Het
Leng8	A	G	7: 4,145,274	T682A	probably damaging	Het
Mslnl	G	T	17: 25,737,842	G34V	possibly damaging	Het
Mycbp2	A	T	14: 103,188,608	S2360R	probably damaging	Het
Mycbp2	C	A	14: 103,188,615		probably null	Het
Nkx2-2	T	C	2: 147,184,399	T140A	probably damaging	Het
Olfr1233	A	T	2: 89,339,705	V199E	possibly damaging	Het
Olfr745	T	C	14: 50,643,067	V262A	probably benign	Het
Oser1	C	T	2: 163,407,045	R79H	probably damaging	Het
Pfas	A	G	11: 68,991,132	V909A	probably damaging	Het
Pkhd1l1	A	G	15: 44,532,992	E1970G	probably benign	Het
Prph2	G	T	17: 46,910,667		probably benign	Het
Rusc2	G	T	4: 43,425,758	A1288S	probably benign	Het
Sdha	A	G	13: 74,323,839		probably null	Het
Sec16a	T	G	2: 26,439,895	T703P	probably benign	Het
Senp7	T	A	16: 56,173,208	N724K	possibly damaging	Het
Skint1	A	G	4: 112,025,502	I248V	probably benign	Het
Slc9a5	T	C	8: 105,357,013	V395A	probably benign	Het
Slco1a4	T	C	6: 141,834,659	N135S	possibly damaging	Het
Sncaip	A	G	18: 52,894,956	I412M	probably damaging	Het
Tacc2	A	T	7: 130,624,051	D841V	possibly damaging	Het
Tekt1	A	T	11: 72,351,837	H281Q	probably benign	Het
Tex46	G	T	4: 136,612,917	M104I	probably benign	Het
Tjp3	T	C	10: 81,278,620		probably null	Het
Treh	A	G	9: 44,682,678	Y154C	probably damaging	Het
Trim80	T	A	11: 115,446,785	L428Q	probably damaging	Het
Trpm6	A	G	19: 18,853,604	K1278E	probably damaging	Het
Usp34	T	C	11: 23,375,024	M990T	possibly damaging	Het
Vps9d1	A	G	8: 123,247,748	S267P	probably benign	Het
Ywhae	T	C	11: 75,756,924	M160T	probably benign	Het
Zcchc11	G	A	4: 108,557,373	R49H	probably damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- AGGGATGTTTGTCAAATGCACTC -3'
(R):5'- GCACACATTTGTCCAAACTTGAG -3'

Sequencing Primer
(F):5'- TAACAATAGGGTCACTATAGC -3'
(R):5'- CATTTGTCCAAACTTGAGAATGAAC -3'

Posted On

2016-11-08