Incidental Mutation 'R5645:Olfr1233'
ID441036
Institutional Source Beutler Lab
Gene Symbol Olfr1233
Ensembl Gene ENSMUSG00000075091
Gene Nameolfactory receptor 1233
SynonymsGA_x6K02T2Q125-50784973-50784056, MOR238-1
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89333208-89342398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89339705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 199 (V199E)
Ref Sequence ENSEMBL: ENSMUSP00000149446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099784] [ENSMUST00000215469] [ENSMUST00000216561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099784
AA Change: V199E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097372
Gene: ENSMUSG00000075091
AA Change: V199E

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.1e-46 PFAM
Pfam:7tm_1 35 281 2.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215018
Predicted Effect possibly damaging
Transcript: ENSMUST00000215469
AA Change: V199E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216561
AA Change: V199E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Olfr1233
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr1233 APN 2 89340022 missense probably benign 0.01
IGL02130:Olfr1233 APN 2 89339583 missense probably damaging 1.00
IGL02264:Olfr1233 APN 2 89339684 missense probably benign 0.33
IGL03155:Olfr1233 APN 2 89339966 missense probably damaging 1.00
R0412:Olfr1233 UTSW 2 89340078 missense probably benign 0.03
R0558:Olfr1233 UTSW 2 89340236 missense probably benign 0.00
R0614:Olfr1233 UTSW 2 89339985 missense probably damaging 0.99
R1138:Olfr1233 UTSW 2 89340090 missense probably benign 0.03
R1969:Olfr1233 UTSW 2 89340296 missense probably damaging 1.00
R2192:Olfr1233 UTSW 2 89339665 nonsense probably null
R4417:Olfr1233 UTSW 2 89339987 missense probably benign 0.11
R5329:Olfr1233 UTSW 2 89339459 missense probably damaging 1.00
R5394:Olfr1233 UTSW 2 89339462 missense probably damaging 1.00
R5949:Olfr1233 UTSW 2 89339885 missense probably damaging 1.00
R7524:Olfr1233 UTSW 2 89339877 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GAAAAGTTGTTACTGGCCGC -3'
(R):5'- TGTGACAAGGATGAACCACCAC -3'

Sequencing Primer
(F):5'- GGCCGCATATATGTATAAATGCATGG -3'
(R):5'- GGATGAACCACCACAATTGCTGTG -3'
Posted On2016-11-08