Incidental Mutation 'R5645:Agbl4'
ID441047
Institutional Source Beutler Lab
Gene Symbol Agbl4
Ensembl Gene ENSMUSG00000061298
Gene NameATP/GTP binding protein-like 4
Synonyms4931433A01Rik, 4930578N11Rik
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location110397661-111664324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111657330 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 513 (I513F)
Ref Sequence ENSEMBL: ENSMUSP00000095533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080744] [ENSMUST00000097920] [ENSMUST00000106592]
Predicted Effect probably benign
Transcript: ENSMUST00000080744
SMART Domains Protein: ENSMUSP00000079568
Gene: ENSMUSG00000061298

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097920
AA Change: I513F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095533
Gene: ENSMUSG00000061298
AA Change: I513F

DomainStartEndE-ValueType
Zn_pept 169 465 3.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106592
SMART Domains Protein: ENSMUSP00000102202
Gene: ENSMUSG00000061298

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154123
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal platelet morphology and physiology, impaired megakaryopoiesis, increased spleen weight and increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Agbl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Agbl4 APN 4 111118884 missense probably damaging 1.00
IGL02961:Agbl4 APN 4 110580121 missense probably damaging 1.00
IGL03383:Agbl4 APN 4 111657423 intron probably benign
IGL03401:Agbl4 APN 4 111119019 missense probably damaging 0.99
I1329:Agbl4 UTSW 4 110478455 splice site probably benign
R0277:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0323:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0690:Agbl4 UTSW 4 111657388 missense probably benign 0.35
R1086:Agbl4 UTSW 4 110478594 splice site probably benign
R1099:Agbl4 UTSW 4 110955663 critical splice donor site probably null
R1172:Agbl4 UTSW 4 111656318 splice site probably benign
R1480:Agbl4 UTSW 4 111566717 missense possibly damaging 0.56
R1508:Agbl4 UTSW 4 111656398 missense probably benign 0.10
R1564:Agbl4 UTSW 4 110955564 splice site probably null
R1610:Agbl4 UTSW 4 111657168 missense probably benign 0.00
R1869:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R1989:Agbl4 UTSW 4 111566682 missense possibly damaging 0.92
R2327:Agbl4 UTSW 4 111526601 missense probably benign 0.00
R4780:Agbl4 UTSW 4 111657331 missense possibly damaging 0.73
R4806:Agbl4 UTSW 4 110955637 missense probably damaging 1.00
R4814:Agbl4 UTSW 4 111656368 missense possibly damaging 0.60
R5077:Agbl4 UTSW 4 111566742 missense probably benign 0.00
R5079:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R5091:Agbl4 UTSW 4 111119040 missense possibly damaging 0.79
R5124:Agbl4 UTSW 4 111656328 missense probably benign 0.21
R5297:Agbl4 UTSW 4 111566698 missense possibly damaging 0.92
R5996:Agbl4 UTSW 4 110955672 unclassified probably null
R6363:Agbl4 UTSW 4 111566785 intron probably benign
R6492:Agbl4 UTSW 4 111547272 missense probably damaging 1.00
R6617:Agbl4 UTSW 4 110580135 missense probably damaging 1.00
R6709:Agbl4 UTSW 4 111566782 intron probably benign
R6873:Agbl4 UTSW 4 111566659 missense possibly damaging 0.76
R7015:Agbl4 UTSW 4 110478500 missense probably damaging 1.00
R7105:Agbl4 UTSW 4 111566723 missense probably benign 0.06
R7143:Agbl4 UTSW 4 111617136 missense probably damaging 1.00
R7413:Agbl4 UTSW 4 111657298 missense probably benign 0.23
R7489:Agbl4 UTSW 4 111526658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGATGGACCCACTTGTAGATC -3'
(R):5'- GTACACAAAGGGCTTCATACAC -3'

Sequencing Primer
(F):5'- TGGACCCACTTGTAGATCCAAGG -3'
(R):5'- GGGCTTCATACACTAAGTAATGGTG -3'
Posted On2016-11-08