Incidental Mutation 'R5645:Cep295'
ID441069
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Namecentrosomal protein 295
SynonymsLOC382128, 5830418K08Rik
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15316915-15357788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15335108 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 684 (S684I)
Ref Sequence ENSEMBL: ENSMUSP00000096578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066038
Predicted Effect possibly damaging
Transcript: ENSMUST00000098979
AA Change: S684I

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: S684I

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160946
SMART Domains Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111

DomainStartEndE-ValueType
coiled coil region 92 119 N/A INTRINSIC
low complexity region 282 293 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
coiled coil region 451 480 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161132
AA Change: S684I

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: S684I

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161795
AA Change: S636I

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: S636I

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
internal_repeat_1 842 1056 7.14e-5 PROSPERO
internal_repeat_1 1229 1441 7.14e-5 PROSPERO
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 1955 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162264
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 unclassified probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0196:Cep295 UTSW 9 15338213 missense probably damaging 0.96
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1889:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4584:Cep295 UTSW 9 15334799 missense possibly damaging 0.96
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5153:Cep295 UTSW 9 15357629 missense probably benign 0.32
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5285:Cep295 UTSW 9 15322591 missense probably benign 0.14
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 unclassified probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
R7428:Cep295 UTSW 9 15333498 missense possibly damaging 0.61
R7697:Cep295 UTSW 9 15354710 missense probably benign 0.01
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACGAACTCATAGTCTCCCTGATG -3'
(R):5'- ATAGGTTACACAAGGAGACTGTTG -3'

Sequencing Primer
(F):5'- CTGATGTGTTTCCACCTGAGAGAAC -3'
(R):5'- CTGTTGAAACTGCCAGGAAAC -3'
Posted On2016-11-08