Mutagenetix > Incidental Mutation

Incidental Mutation 'R5645:Pfas'

441082

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

043293-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5645 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68991132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 909 (V909A)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000021282
AA Change: V909A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: V909A

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146490

Predicted Effect

probably benign
Transcript: ENSMUST00000149703

SMART Domains

Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	3	110	4e-12	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000152964
AA Change: V13A

SMART Domains

Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: V13A

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	2	94	1.6e-12	PFAM
GATase_5	166	468	6.88e-120	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174986

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	G	9: 108,397,204	I169V	probably damaging	Het
2310007B03Rik	T	C	1: 93,152,946	T413A	probably damaging	Het
4930503B20Rik	C	T	3: 146,650,509	E215K	probably damaging	Het
5830411N06Rik	G	A	7: 140,248,940	V171I	possibly damaging	Het
Abca6	T	C	11: 110,250,408	E29G	probably damaging	Het
Acsm1	A	G	7: 119,640,697	H288R	probably damaging	Het
Adamts12	A	G	15: 11,277,420	T707A	possibly damaging	Het
Adcy2	C	A	13: 68,729,202		probably null	Het
Agbl4	A	T	4: 111,657,330	I513F	possibly damaging	Het
Ak5	A	T	3: 152,656,033	M84K	possibly damaging	Het
Akap1	T	C	11: 88,845,627	T103A	probably benign	Het
Akap9	A	G	5: 4,050,590	T2751A	probably benign	Het
Amer3	A	T	1: 34,588,381	H567L	possibly damaging	Het
Ano6	A	G	15: 95,920,351	Y325C	probably benign	Het
Apba2	A	G	7: 64,695,806	E248G	possibly damaging	Het
Asap2	T	A	12: 21,265,982	V967E	probably damaging	Het
Boc	A	G	16: 44,499,661	V320A	probably damaging	Het
Car13	T	A	3: 14,645,120	Y41N	possibly damaging	Het
Ccdc162	T	C	10: 41,552,356	T1976A	probably benign	Het
Cep295	A	T	9: 15,332,794	H1455Q	probably damaging	Het
Cep295	C	A	9: 15,335,108	S684I	possibly damaging	Het
Cr2	G	T	1: 195,154,273	H861N	probably damaging	Het
Cul5	T	C	9: 53,622,943	I630V	probably benign	Het
Cyp2c37	G	A	19: 39,994,152	V145I	probably benign	Het
Dnmt1	G	A	9: 20,922,147	T500M	probably damaging	Het
Fam161a	T	A	11: 23,015,725	I6N	probably damaging	Het
Fam214a	T	A	9: 75,025,679	V976E	probably damaging	Het
Fry	T	C	5: 150,380,867	V574A	probably damaging	Het
Glb1l3	G	T	9: 26,824,826	L553I	probably benign	Het
Gm1123	T	C	9: 99,014,191	D212G	probably benign	Het
Grin2a	T	A	16: 9,992,226	D103V	probably damaging	Het
Heg1	A	G	16: 33,706,963	I98V	probably benign	Het
Hmcn2	C	A	2: 31,420,812	T3356N	possibly damaging	Het
Hpf1	T	G	8: 60,896,800	I154S	possibly damaging	Het
Ifnar2	A	G	16: 91,404,227	D452G	possibly damaging	Het
Ikbkap	T	C	4: 56,776,920	T626A	possibly damaging	Het
Iqcc	A	T	4: 129,616,527	H398Q	possibly damaging	Het
Iqgap3	T	C	3: 88,117,699	I669T	probably damaging	Het
Itgae	A	G	11: 73,129,248	T859A	probably damaging	Het
Kansl1l	T	C	1: 66,801,344	M266V	probably benign	Het
Kbtbd3	A	G	9: 4,331,426	D600G	possibly damaging	Het
Klf13	G	A	7: 63,891,600		probably benign	Het
Kmt2d	A	G	15: 98,844,397		probably benign	Het
Lama1	A	G	17: 67,802,948	D2188G	probably damaging	Het
Leng8	A	G	7: 4,145,274	T682A	probably damaging	Het
Mslnl	G	T	17: 25,737,842	G34V	possibly damaging	Het
Mycbp2	A	T	14: 103,188,608	S2360R	probably damaging	Het
Mycbp2	C	A	14: 103,188,615		probably null	Het
Nkx2-2	T	C	2: 147,184,399	T140A	probably damaging	Het
Olfr1233	A	T	2: 89,339,705	V199E	possibly damaging	Het
Olfr745	T	C	14: 50,643,067	V262A	probably benign	Het
Oser1	C	T	2: 163,407,045	R79H	probably damaging	Het
Pkhd1l1	A	G	15: 44,532,992	E1970G	probably benign	Het
Prph2	G	T	17: 46,910,667		probably benign	Het
Rusc2	G	T	4: 43,425,758	A1288S	probably benign	Het
Sdha	A	G	13: 74,323,839		probably null	Het
Sec16a	T	G	2: 26,439,895	T703P	probably benign	Het
Senp7	T	A	16: 56,173,208	N724K	possibly damaging	Het
Skint1	A	G	4: 112,025,502	I248V	probably benign	Het
Slc9a5	T	C	8: 105,357,013	V395A	probably benign	Het
Slco1a4	T	C	6: 141,834,659	N135S	possibly damaging	Het
Sncaip	A	G	18: 52,894,956	I412M	probably damaging	Het
Tacc2	A	T	7: 130,624,051	D841V	possibly damaging	Het
Tekt1	A	T	11: 72,351,837	H281Q	probably benign	Het
Tex46	G	T	4: 136,612,917	M104I	probably benign	Het
Tjp3	T	C	10: 81,278,620		probably null	Het
Treh	A	G	9: 44,682,678	Y154C	probably damaging	Het
Trim80	T	A	11: 115,446,785	L428Q	probably damaging	Het
Trpm6	A	G	19: 18,853,604	K1278E	probably damaging	Het
Usp34	T	C	11: 23,375,024	M990T	possibly damaging	Het
Vps9d1	A	G	8: 123,247,748	S267P	probably benign	Het
Ywhae	T	C	11: 75,756,924	M160T	probably benign	Het
Zcchc11	G	A	4: 108,557,373	R49H	probably damaging	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8248:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
R9644:Pfas	UTSW	11	68992716	missense	probably benign	0.23
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGCCAAGACTCAGGAGATAG -3'
(R):5'- TGCCTTTCATATCACCCAGGG -3'

Sequencing Primer
(F):5'- GATAGGGTCAGAGATACCACATTC -3'
(R):5'- TGGCTCTCTAGATGCTCTG -3'

Posted On

2016-11-08