Incidental Mutation 'R5645:Itgae'
ID 441084
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms alpha-E1, CD103
MMRRC Submission 043293-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5645 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 72981409-73038272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73020074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 859 (T859A)
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
AlphaFold Q60677
Predicted Effect probably damaging
Transcript: ENSMUST00000006101
AA Change: T859A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: T859A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102537
AA Change: T859A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: T859A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,274,403 (GRCm39) I169V probably damaging Het
4930503B20Rik C T 3: 146,356,264 (GRCm39) E215K probably damaging Het
Abca6 T C 11: 110,141,234 (GRCm39) E29G probably damaging Het
Acsm1 A G 7: 119,239,920 (GRCm39) H288R probably damaging Het
Adamts12 A G 15: 11,277,506 (GRCm39) T707A possibly damaging Het
Adcy2 C A 13: 68,877,321 (GRCm39) probably null Het
Agbl4 A T 4: 111,514,527 (GRCm39) I513F possibly damaging Het
Ak5 A T 3: 152,361,670 (GRCm39) M84K possibly damaging Het
Akap1 T C 11: 88,736,453 (GRCm39) T103A probably benign Het
Akap9 A G 5: 4,100,590 (GRCm39) T2751A probably benign Het
Amer3 A T 1: 34,627,462 (GRCm39) H567L possibly damaging Het
Ano6 A G 15: 95,818,232 (GRCm39) Y325C probably benign Het
Apba2 A G 7: 64,345,554 (GRCm39) E248G possibly damaging Het
Asap2 T A 12: 21,315,983 (GRCm39) V967E probably damaging Het
Atosa T A 9: 74,932,961 (GRCm39) V976E probably damaging Het
Boc A G 16: 44,320,024 (GRCm39) V320A probably damaging Het
Car13 T A 3: 14,710,180 (GRCm39) Y41N possibly damaging Het
Ccdc162 T C 10: 41,428,352 (GRCm39) T1976A probably benign Het
Cep295 C A 9: 15,246,404 (GRCm39) S684I possibly damaging Het
Cep295 A T 9: 15,244,090 (GRCm39) H1455Q probably damaging Het
Cr2 G T 1: 194,836,581 (GRCm39) H861N probably damaging Het
Cul5 T C 9: 53,534,243 (GRCm39) I630V probably benign Het
Cyp2c37 G A 19: 39,982,596 (GRCm39) V145I probably benign Het
Dnmt1 G A 9: 20,833,443 (GRCm39) T500M probably damaging Het
Elp1 T C 4: 56,776,920 (GRCm39) T626A possibly damaging Het
Fam161a T A 11: 22,965,725 (GRCm39) I6N probably damaging Het
Fry T C 5: 150,304,332 (GRCm39) V574A probably damaging Het
Glb1l3 G T 9: 26,736,122 (GRCm39) L553I probably benign Het
Gm1123 T C 9: 98,896,244 (GRCm39) D212G probably benign Het
Grin2a T A 16: 9,810,090 (GRCm39) D103V probably damaging Het
Heg1 A G 16: 33,527,333 (GRCm39) I98V probably benign Het
Hmcn2 C A 2: 31,310,824 (GRCm39) T3356N possibly damaging Het
Hpf1 T G 8: 61,349,834 (GRCm39) I154S possibly damaging Het
Ifnar2 A G 16: 91,201,115 (GRCm39) D452G possibly damaging Het
Iqcc A T 4: 129,510,320 (GRCm39) H398Q possibly damaging Het
Iqgap3 T C 3: 88,025,006 (GRCm39) I669T probably damaging Het
Kansl1l T C 1: 66,840,503 (GRCm39) M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 (GRCm39) D600G possibly damaging Het
Klf13 G A 7: 63,541,348 (GRCm39) probably benign Het
Kmt2d A G 15: 98,742,278 (GRCm39) probably benign Het
Lama1 A G 17: 68,109,943 (GRCm39) D2188G probably damaging Het
Leng8 A G 7: 4,148,273 (GRCm39) T682A probably damaging Het
Mab21l4 T C 1: 93,080,668 (GRCm39) T413A probably damaging Het
Mslnl G T 17: 25,956,816 (GRCm39) G34V possibly damaging Het
Mycbp2 A T 14: 103,426,044 (GRCm39) S2360R probably damaging Het
Mycbp2 C A 14: 103,426,051 (GRCm39) probably null Het
Nkx2-2 T C 2: 147,026,319 (GRCm39) T140A probably damaging Het
Or11h6 T C 14: 50,880,524 (GRCm39) V262A probably benign Het
Or4c125 A T 2: 89,170,049 (GRCm39) V199E possibly damaging Het
Oser1 C T 2: 163,248,965 (GRCm39) R79H probably damaging Het
Pfas A G 11: 68,881,958 (GRCm39) V909A probably damaging Het
Pkhd1l1 A G 15: 44,396,388 (GRCm39) E1970G probably benign Het
Prph2 G T 17: 47,221,593 (GRCm39) probably benign Het
Rusc2 G T 4: 43,425,758 (GRCm39) A1288S probably benign Het
Scart2 G A 7: 139,828,853 (GRCm39) V171I possibly damaging Het
Sdha A G 13: 74,471,958 (GRCm39) probably null Het
Sec16a T G 2: 26,329,907 (GRCm39) T703P probably benign Het
Senp7 T A 16: 55,993,571 (GRCm39) N724K possibly damaging Het
Skint1 A G 4: 111,882,699 (GRCm39) I248V probably benign Het
Slc9a5 T C 8: 106,083,645 (GRCm39) V395A probably benign Het
Slco1a4 T C 6: 141,780,385 (GRCm39) N135S possibly damaging Het
Sncaip A G 18: 53,028,028 (GRCm39) I412M probably damaging Het
Tacc2 A T 7: 130,225,781 (GRCm39) D841V possibly damaging Het
Tekt1 A T 11: 72,242,663 (GRCm39) H281Q probably benign Het
Tex46 G T 4: 136,340,228 (GRCm39) M104I probably benign Het
Tjp3 T C 10: 81,114,454 (GRCm39) probably null Het
Treh A G 9: 44,593,975 (GRCm39) Y154C probably damaging Het
Trim80 T A 11: 115,337,611 (GRCm39) L428Q probably damaging Het
Trpm6 A G 19: 18,830,968 (GRCm39) K1278E probably damaging Het
Tut4 G A 4: 108,414,570 (GRCm39) R49H probably damaging Het
Usp34 T C 11: 23,325,024 (GRCm39) M990T possibly damaging Het
Vps9d1 A G 8: 123,974,487 (GRCm39) S267P probably benign Het
Ywhae T C 11: 75,647,750 (GRCm39) M160T probably benign Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73,036,461 (GRCm39) missense probably benign 0.17
IGL00472:Itgae APN 11 73,004,520 (GRCm39) missense probably benign 0.06
IGL00821:Itgae APN 11 73,013,974 (GRCm39) missense probably damaging 1.00
IGL01625:Itgae APN 11 73,010,263 (GRCm39) missense probably benign 0.00
IGL01639:Itgae APN 11 73,010,204 (GRCm39) missense probably benign 0.00
IGL01743:Itgae APN 11 73,002,585 (GRCm39) missense probably benign 0.02
IGL01911:Itgae APN 11 73,006,963 (GRCm39) missense probably damaging 1.00
IGL01949:Itgae APN 11 73,009,010 (GRCm39) missense probably benign 0.29
IGL02149:Itgae APN 11 72,994,720 (GRCm39) missense probably benign 0.04
IGL02179:Itgae APN 11 73,024,844 (GRCm39) missense probably benign 0.06
IGL02231:Itgae APN 11 72,981,448 (GRCm39) missense possibly damaging 0.88
IGL02292:Itgae APN 11 73,009,361 (GRCm39) missense probably damaging 0.98
IGL02378:Itgae APN 11 73,008,947 (GRCm39) missense probably benign 0.00
IGL02525:Itgae APN 11 73,021,777 (GRCm39) missense probably damaging 0.98
IGL02576:Itgae APN 11 73,009,331 (GRCm39) missense possibly damaging 0.95
IGL02729:Itgae APN 11 73,009,029 (GRCm39) splice site probably benign
IGL02859:Itgae APN 11 73,005,693 (GRCm39) missense probably damaging 1.00
IGL03074:Itgae APN 11 73,016,136 (GRCm39) missense probably benign 0.00
IGL03107:Itgae APN 11 73,004,427 (GRCm39) missense probably damaging 1.00
IGL03264:Itgae APN 11 73,006,400 (GRCm39) missense possibly damaging 0.73
IGL03272:Itgae APN 11 73,024,680 (GRCm39) splice site probably null
IGL03352:Itgae APN 11 73,022,556 (GRCm39) missense probably damaging 1.00
R0134:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0225:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0320:Itgae UTSW 11 73,021,825 (GRCm39) missense possibly damaging 0.74
R0344:Itgae UTSW 11 73,008,973 (GRCm39) missense probably benign 0.13
R0403:Itgae UTSW 11 73,014,009 (GRCm39) missense possibly damaging 0.89
R0631:Itgae UTSW 11 73,005,733 (GRCm39) missense probably damaging 1.00
R0833:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0836:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0973:Itgae UTSW 11 73,029,335 (GRCm39) nonsense probably null
R1231:Itgae UTSW 11 73,010,205 (GRCm39) missense probably benign 0.02
R1389:Itgae UTSW 11 73,016,188 (GRCm39) missense probably damaging 1.00
R1433:Itgae UTSW 11 73,006,418 (GRCm39) missense probably damaging 1.00
R1534:Itgae UTSW 11 73,036,431 (GRCm39) missense possibly damaging 0.58
R1833:Itgae UTSW 11 73,007,988 (GRCm39) missense possibly damaging 0.94
R1914:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R1915:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R2061:Itgae UTSW 11 73,009,448 (GRCm39) missense probably benign 0.00
R2380:Itgae UTSW 11 73,036,395 (GRCm39) missense probably benign 0.00
R2435:Itgae UTSW 11 73,012,763 (GRCm39) nonsense probably null
R2680:Itgae UTSW 11 73,005,752 (GRCm39) missense probably damaging 1.00
R2886:Itgae UTSW 11 73,031,513 (GRCm39) missense probably benign 0.04
R3873:Itgae UTSW 11 73,004,442 (GRCm39) missense probably damaging 1.00
R3923:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R4010:Itgae UTSW 11 73,002,165 (GRCm39) missense probably benign 0.00
R4059:Itgae UTSW 11 73,002,960 (GRCm39) missense probably benign
R4212:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4213:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4691:Itgae UTSW 11 73,010,345 (GRCm39) nonsense probably null
R4736:Itgae UTSW 11 73,005,706 (GRCm39) missense possibly damaging 0.79
R5152:Itgae UTSW 11 73,021,821 (GRCm39) missense probably damaging 1.00
R5201:Itgae UTSW 11 73,001,382 (GRCm39) missense probably benign 0.00
R5307:Itgae UTSW 11 73,036,464 (GRCm39) missense probably benign 0.00
R5362:Itgae UTSW 11 73,002,675 (GRCm39) missense probably damaging 1.00
R5448:Itgae UTSW 11 73,024,734 (GRCm39) critical splice donor site probably null
R5672:Itgae UTSW 11 73,036,377 (GRCm39) missense possibly damaging 0.96
R6079:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6138:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6226:Itgae UTSW 11 73,031,583 (GRCm39) missense probably benign 0.11
R6244:Itgae UTSW 11 73,036,427 (GRCm39) missense probably damaging 0.96
R6326:Itgae UTSW 11 73,022,519 (GRCm39) missense possibly damaging 0.88
R6332:Itgae UTSW 11 73,002,228 (GRCm39) splice site probably null
R6502:Itgae UTSW 11 73,036,418 (GRCm39) missense probably benign 0.10
R6825:Itgae UTSW 11 73,009,322 (GRCm39) missense possibly damaging 0.89
R7016:Itgae UTSW 11 73,010,342 (GRCm39) missense probably damaging 0.99
R7020:Itgae UTSW 11 73,002,195 (GRCm39) missense probably damaging 1.00
R7069:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R7132:Itgae UTSW 11 73,002,184 (GRCm39) missense possibly damaging 0.93
R7473:Itgae UTSW 11 73,031,504 (GRCm39) missense possibly damaging 0.87
R7599:Itgae UTSW 11 73,012,786 (GRCm39) missense possibly damaging 0.62
R7637:Itgae UTSW 11 73,004,457 (GRCm39) missense probably damaging 1.00
R7763:Itgae UTSW 11 73,014,095 (GRCm39) critical splice donor site probably null
R7829:Itgae UTSW 11 73,029,618 (GRCm39) missense probably benign
R7860:Itgae UTSW 11 73,011,099 (GRCm39) critical splice acceptor site probably null
R7978:Itgae UTSW 11 73,024,913 (GRCm39) missense probably damaging 0.98
R8197:Itgae UTSW 11 73,011,210 (GRCm39) missense probably benign
R8911:Itgae UTSW 11 73,004,447 (GRCm39) missense probably damaging 1.00
R9155:Itgae UTSW 11 73,016,089 (GRCm39) missense possibly damaging 0.94
R9284:Itgae UTSW 11 73,012,752 (GRCm39) missense probably benign 0.25
R9355:Itgae UTSW 11 73,006,906 (GRCm39) missense probably damaging 1.00
R9414:Itgae UTSW 11 73,002,629 (GRCm39) missense possibly damaging 0.59
R9595:Itgae UTSW 11 73,016,182 (GRCm39) missense probably damaging 0.99
R9618:Itgae UTSW 11 73,011,171 (GRCm39) missense possibly damaging 0.78
U15987:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
X0024:Itgae UTSW 11 73,002,202 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1186:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1186:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1187:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1187:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1187:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1188:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1188:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1189:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1189:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1189:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1190:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1190:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1190:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1191:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1191:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1191:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1192:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1192:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1192:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CTGGGCCTTTATGCAGTTTATC -3'
(R):5'- ATCGCTATGCCTGTACTGC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATAGG -3'
(R):5'- TGCCTGTACTGCATGGGGC -3'
Posted On 2016-11-08