Incidental Mutation 'R5646:Olfr550'
ID441154
Institutional Source Beutler Lab
Gene Symbol Olfr550
Ensembl Gene ENSMUSG00000073975
Gene Nameolfactory receptor 550
SynonymsMOR16-1, GA_x6K02T2PBJ9-5297243-5298193
MMRRC Submission 043294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5646 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102571442-102583011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 102579305 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 270 (Y270S)
Ref Sequence ENSEMBL: ENSMUSP00000149536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098225] [ENSMUST00000213540] [ENSMUST00000216524]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098225
AA Change: Y270S

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095828
Gene: ENSMUSG00000073975
AA Change: Y270S

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 6.2e-102 PFAM
Pfam:7TM_GPCR_Srsx 36 156 1.8e-10 PFAM
Pfam:7tm_1 42 293 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213540
Predicted Effect possibly damaging
Transcript: ENSMUST00000216524
AA Change: Y270S

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,776 S4467P probably damaging Het
Add1 C A 5: 34,630,680 A691D probably benign Het
Agap3 C A 5: 24,483,397 D394E probably benign Het
Arhgef11 T C 3: 87,684,486 V59A possibly damaging Het
Atp2a1 A G 7: 126,453,105 V402A probably benign Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Bsn A T 9: 108,110,432 probably benign Het
Camk1 A G 6: 113,339,340 V81A probably damaging Het
Cass4 T G 2: 172,416,245 C54W probably damaging Het
Ccdc39 A T 3: 33,825,550 F456L probably damaging Het
Cdc42bpa A G 1: 180,106,094 E766G probably damaging Het
Cdcp2 T C 4: 107,105,142 C171R probably damaging Het
Cdh9 G A 15: 16,823,285 E118K probably damaging Het
Col4a2 G A 8: 11,441,281 G1227R probably damaging Het
Cyp2d9 A G 15: 82,452,464 T5A probably benign Het
Dlg5 T A 14: 24,158,699 D813V probably damaging Het
Dmtf1 G A 5: 9,124,515 S405F possibly damaging Het
Drd2 A G 9: 49,404,912 K324R probably benign Het
Ergic1 T C 17: 26,614,358 S29P probably damaging Het
Fmnl1 A G 11: 103,196,512 probably benign Het
Foxd2 C T 4: 114,908,635 A63T unknown Het
Gfap T C 11: 102,891,456 I409M probably benign Het
Gfpt1 A G 6: 87,042,999 M1V probably null Het
H2-T23 C G 17: 36,031,803 E148Q possibly damaging Het
Hip1 G A 5: 135,428,741 R704W probably damaging Het
Kif19a A C 11: 114,779,654 D130A probably damaging Het
Lin7b T C 7: 45,369,193 D14G probably damaging Het
Meioc T A 11: 102,675,257 N510K possibly damaging Het
Mettl5 C A 2: 69,881,319 G68* probably null Het
Mitf A T 6: 98,013,694 I184F probably damaging Het
Mmp9 T A 2: 164,949,050 H119Q probably benign Het
Mycbp2 T A 14: 103,169,910 H2768L probably benign Het
Myh2 A T 11: 67,188,812 I1032F probably benign Het
Myo3b T C 2: 70,314,430 I1110T probably damaging Het
Nde1 T C 16: 14,169,514 F8L probably damaging Het
Olfr1317 T C 2: 112,142,683 V246A possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr432 C T 1: 174,051,287 Q305* probably null Het
Olfr447 A G 6: 42,911,523 probably null Het
Olfr753-ps1 T C 17: 37,169,917 I244V probably benign Het
Olfr771 T C 10: 129,160,837 D49G possibly damaging Het
Pcdhga8 A G 18: 37,726,770 H293R probably benign Het
Pde7a A T 3: 19,233,773 L244Q probably damaging Het
Pex14 T C 4: 148,961,453 D340G probably benign Het
Pfkfb4 A T 9: 109,008,421 I195F probably damaging Het
Pik3c2a C A 7: 116,405,951 G361W probably damaging Het
Prkcg T A 7: 3,329,081 M517K probably damaging Het
Prob1 A T 18: 35,654,114 F362L probably benign Het
Rims4 C T 2: 163,864,017 W232* probably null Het
Robo2 T C 16: 73,961,819 D688G probably damaging Het
Sec24c C A 14: 20,679,573 A73E probably benign Het
Slc15a3 A G 19: 10,843,210 N64D probably benign Het
Smg1 A T 7: 118,212,559 N65K probably benign Het
Sptb G T 12: 76,587,441 D2165E probably benign Het
Sptbn5 A T 2: 120,048,811 noncoding transcript Het
Syt12 A T 19: 4,456,541 M192K possibly damaging Het
Tas2r107 A G 6: 131,659,708 V126A probably benign Het
Thbs3 T C 3: 89,219,098 L242P probably damaging Het
Timp2 A T 11: 118,317,532 probably null Het
Tmtc1 G A 6: 148,246,831 A751V probably damaging Het
Tnni2 A T 7: 142,443,913 D85V probably damaging Het
Ttc39b G A 4: 83,244,070 P319L probably damaging Het
Ttc6 A T 12: 57,576,019 K68M probably damaging Het
Usp25 G A 16: 77,050,472 R156Q probably benign Het
Vill A T 9: 119,071,162 D365V probably damaging Het
Vmn1r65 T A 7: 6,009,224 T4S probably benign Het
Vmn2r76 C A 7: 86,226,053 C572F probably damaging Het
Vps26a A C 10: 62,468,298 N181K probably damaging Het
Xirp2 T C 2: 67,510,790 L1125P probably damaging Het
Zbtb41 T G 1: 139,423,763 S205A probably benign Het
Zfp438 T C 18: 5,214,526 D144G probably benign Het
Zfp600 T C 4: 146,195,100 S113P probably damaging Het
Zfp84 C T 7: 29,776,393 T170M probably benign Het
Zmiz2 T A 11: 6,402,837 D654E probably damaging Het
Zswim4 A T 8: 84,231,110 probably null Het
Other mutations in Olfr550
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Olfr550 APN 7 102578527 unclassified probably null
IGL02605:Olfr550 APN 7 102579395 missense probably damaging 1.00
IGL03365:Olfr550 APN 7 102578629 missense probably benign
R0180:Olfr550 UTSW 7 102579032 missense probably damaging 1.00
R3854:Olfr550 UTSW 7 102579020 missense probably damaging 1.00
R5337:Olfr550 UTSW 7 102579274 missense probably damaging 1.00
R5606:Olfr550 UTSW 7 102579274 missense probably damaging 1.00
R6009:Olfr550 UTSW 7 102578594 missense possibly damaging 0.86
R6751:Olfr550 UTSW 7 102578499 start codon destroyed probably null
R7767:Olfr550 UTSW 7 102571764 start gained probably benign
X0067:Olfr550 UTSW 7 102578500 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCTACTGTCTGCACTGC -3'
(R):5'- TCATAGTGGTCCACTGAGGTC -3'

Sequencing Primer
(F):5'- ACTGGCTTGCTCAGACAC -3'
(R):5'- AGTGGTCCACTGAGGTCATATATTTC -3'
Posted On2016-11-08