Incidental Mutation 'R5646:Pfkfb4'
ID 441166
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission 043294-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5646 (G1)
Quality Score 222
Status Not validated
Chromosome 9
Chromosomal Location 108820846-108861296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108837489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 195 (I195F)
Ref Sequence ENSEMBL: ENSMUSP00000142992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
AlphaFold Q6DTY7
Predicted Effect probably damaging
Transcript: ENSMUST00000051873
AA Change: I179F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: I179F

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably damaging
Transcript: ENSMUST00000198140
AA Change: I195F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: I195F

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199184
Predicted Effect probably damaging
Transcript: ENSMUST00000199591
AA Change: I195F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: I195F

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200229
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add1 C A 5: 34,788,024 (GRCm39) A691D probably benign Het
Agap3 C A 5: 24,688,395 (GRCm39) D394E probably benign Het
Arhgef11 T C 3: 87,591,793 (GRCm39) V59A possibly damaging Het
Atp2a1 A G 7: 126,052,277 (GRCm39) V402A probably benign Het
Bbs9 T C 9: 22,490,011 (GRCm39) F261L probably benign Het
Bsn A T 9: 107,987,631 (GRCm39) probably benign Het
Camk1 A G 6: 113,316,301 (GRCm39) V81A probably damaging Het
Cass4 T G 2: 172,258,165 (GRCm39) C54W probably damaging Het
Ccdc39 A T 3: 33,879,699 (GRCm39) F456L probably damaging Het
Cdc42bpa A G 1: 179,933,659 (GRCm39) E766G probably damaging Het
Cdcp2 T C 4: 106,962,339 (GRCm39) C171R probably damaging Het
Cdh9 G A 15: 16,823,371 (GRCm39) E118K probably damaging Het
Col4a2 G A 8: 11,491,281 (GRCm39) G1227R probably damaging Het
Cyp2d9 A G 15: 82,336,665 (GRCm39) T5A probably benign Het
Dlg5 T A 14: 24,208,767 (GRCm39) D813V probably damaging Het
Dmtf1 G A 5: 9,174,515 (GRCm39) S405F possibly damaging Het
Drd2 A G 9: 49,316,212 (GRCm39) K324R probably benign Het
Ergic1 T C 17: 26,833,332 (GRCm39) S29P probably damaging Het
Fmnl1 A G 11: 103,087,338 (GRCm39) probably benign Het
Foxd2 C T 4: 114,765,832 (GRCm39) A63T unknown Het
Gfap T C 11: 102,782,282 (GRCm39) I409M probably benign Het
Gfpt1 A G 6: 87,019,981 (GRCm39) M1V probably null Het
H2-T23 C G 17: 36,342,695 (GRCm39) E148Q possibly damaging Het
Hip1 G A 5: 135,457,595 (GRCm39) R704W probably damaging Het
Kif19a A C 11: 114,670,480 (GRCm39) D130A probably damaging Het
Lin7b T C 7: 45,018,617 (GRCm39) D14G probably damaging Het
Meioc T A 11: 102,566,083 (GRCm39) N510K possibly damaging Het
Mettl5 C A 2: 69,711,663 (GRCm39) G68* probably null Het
Mitf A T 6: 97,990,655 (GRCm39) I184F probably damaging Het
Mmp9 T A 2: 164,790,970 (GRCm39) H119Q probably benign Het
Mycbp2 T A 14: 103,407,346 (GRCm39) H2768L probably benign Het
Myh2 A T 11: 67,079,638 (GRCm39) I1032F probably benign Het
Myo3b T C 2: 70,144,774 (GRCm39) I1110T probably damaging Het
Nde1 T C 16: 13,987,378 (GRCm39) F8L probably damaging Het
Or10aa3 C T 1: 173,878,853 (GRCm39) Q305* probably null Het
Or2a25 A G 6: 42,888,457 (GRCm39) probably null Het
Or2h2b-ps1 T C 17: 37,480,808 (GRCm39) I244V probably benign Het
Or4f47 T C 2: 111,973,028 (GRCm39) V246A possibly damaging Het
Or51r1 A C 7: 102,228,512 (GRCm39) Y270S possibly damaging Het
Or5ac20 C T 16: 59,104,342 (GRCm39) V173I probably benign Het
Or6c202 T C 10: 128,996,706 (GRCm39) D49G possibly damaging Het
Pcdhga8 A G 18: 37,859,823 (GRCm39) H293R probably benign Het
Pde7a A T 3: 19,287,937 (GRCm39) L244Q probably damaging Het
Pex14 T C 4: 149,045,910 (GRCm39) D340G probably benign Het
Pik3c2a C A 7: 116,005,186 (GRCm39) G361W probably damaging Het
Prkcg T A 7: 3,377,597 (GRCm39) M517K probably damaging Het
Prob1 A T 18: 35,787,167 (GRCm39) F362L probably benign Het
Rims4 C T 2: 163,705,937 (GRCm39) W232* probably null Het
Robo2 T C 16: 73,758,707 (GRCm39) D688G probably damaging Het
Sec24c C A 14: 20,729,641 (GRCm39) A73E probably benign Het
Slc15a3 A G 19: 10,820,574 (GRCm39) N64D probably benign Het
Smg1 A T 7: 117,811,782 (GRCm39) N65K probably benign Het
Spata31h1 A G 10: 82,119,610 (GRCm39) S4467P probably damaging Het
Sptb G T 12: 76,634,215 (GRCm39) D2165E probably benign Het
Sptbn5 A T 2: 119,879,292 (GRCm39) noncoding transcript Het
Syt12 A T 19: 4,506,569 (GRCm39) M192K possibly damaging Het
Tas2r107 A G 6: 131,636,671 (GRCm39) V126A probably benign Het
Thbs3 T C 3: 89,126,405 (GRCm39) L242P probably damaging Het
Timp2 A T 11: 118,208,358 (GRCm39) probably null Het
Tmtc1 G A 6: 148,148,329 (GRCm39) A751V probably damaging Het
Tnni2 A T 7: 141,997,650 (GRCm39) D85V probably damaging Het
Ttc39b G A 4: 83,162,307 (GRCm39) P319L probably damaging Het
Ttc6 A T 12: 57,622,805 (GRCm39) K68M probably damaging Het
Usp25 G A 16: 76,847,360 (GRCm39) R156Q probably benign Het
Vill A T 9: 118,900,230 (GRCm39) D365V probably damaging Het
Vmn1r65 T A 7: 6,012,223 (GRCm39) T4S probably benign Het
Vmn2r76 C A 7: 85,875,261 (GRCm39) C572F probably damaging Het
Vps26a A C 10: 62,304,077 (GRCm39) N181K probably damaging Het
Xirp2 T C 2: 67,341,134 (GRCm39) L1125P probably damaging Het
Zbtb41 T G 1: 139,351,501 (GRCm39) S205A probably benign Het
Zfp438 T C 18: 5,214,526 (GRCm39) D144G probably benign Het
Zfp600 T C 4: 146,131,670 (GRCm39) S113P probably damaging Het
Zfp84 C T 7: 29,475,818 (GRCm39) T170M probably benign Het
Zmiz2 T A 11: 6,352,837 (GRCm39) D654E probably damaging Het
Zswim4 A T 8: 84,957,739 (GRCm39) probably null Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108,828,202 (GRCm39) missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 108,858,010 (GRCm39) missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 108,859,404 (GRCm39) missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 108,836,364 (GRCm39) missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 108,836,769 (GRCm39) missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 108,839,711 (GRCm39) missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 108,856,810 (GRCm39) splice site probably benign
R0511:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 108,856,688 (GRCm39) missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 108,836,373 (GRCm39) missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108,828,237 (GRCm39) missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 108,834,677 (GRCm39) missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 108,854,110 (GRCm39) splice site probably benign
R5470:Pfkfb4 UTSW 9 108,856,661 (GRCm39) missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 108,859,462 (GRCm39) unclassified probably benign
R6139:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 108,838,630 (GRCm39) splice site probably null
R6873:Pfkfb4 UTSW 9 108,839,403 (GRCm39) splice site probably null
R6958:Pfkfb4 UTSW 9 108,839,615 (GRCm39) missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 108,836,370 (GRCm39) missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 108,856,676 (GRCm39) missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 108,840,308 (GRCm39) missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108,828,019 (GRCm39) missense probably damaging 1.00
R7973:Pfkfb4 UTSW 9 108,854,179 (GRCm39) missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 108,834,667 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATTCCTGATGGGAGCAGTCC -3'
(R):5'- CCTCCTGCATAGAAATTAGGTTTG -3'

Sequencing Primer
(F):5'- AGTCCCCAGCTAGGCTCTG -3'
(R):5'- ATGAGTGTTCTGTAAGCCACC -3'
Posted On 2016-11-08