Incidental Mutation 'R5646:Vill'
ID441167
Institutional Source Beutler Lab
Gene Symbol Vill
Ensembl Gene ENSMUSG00000038775
Gene Namevillin-like
SynonymsVillp
MMRRC Submission 043294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5646 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119052778-119071525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119071162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 365 (D365V)
Ref Sequence ENSEMBL: ENSMUSP00000116262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000136561] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]
Predicted Effect probably benign
Transcript: ENSMUST00000010804
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000051386
AA Change: D832V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: D832V

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000074734
AA Change: D748V

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: D748V

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126251
AA Change: D365V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775
AA Change: D365V

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136561
SMART Domains Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 1 96 2.46e-13 SMART
Blast:GEL 116 140 2e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000141185
AA Change: D448V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775
AA Change: D448V

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Predicted Effect probably benign
Transcript: ENSMUST00000213464
Predicted Effect probably benign
Transcript: ENSMUST00000214470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214491
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,776 S4467P probably damaging Het
Add1 C A 5: 34,630,680 A691D probably benign Het
Agap3 C A 5: 24,483,397 D394E probably benign Het
Arhgef11 T C 3: 87,684,486 V59A possibly damaging Het
Atp2a1 A G 7: 126,453,105 V402A probably benign Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Bsn A T 9: 108,110,432 probably benign Het
Camk1 A G 6: 113,339,340 V81A probably damaging Het
Cass4 T G 2: 172,416,245 C54W probably damaging Het
Ccdc39 A T 3: 33,825,550 F456L probably damaging Het
Cdc42bpa A G 1: 180,106,094 E766G probably damaging Het
Cdcp2 T C 4: 107,105,142 C171R probably damaging Het
Cdh9 G A 15: 16,823,285 E118K probably damaging Het
Col4a2 G A 8: 11,441,281 G1227R probably damaging Het
Cyp2d9 A G 15: 82,452,464 T5A probably benign Het
Dlg5 T A 14: 24,158,699 D813V probably damaging Het
Dmtf1 G A 5: 9,124,515 S405F possibly damaging Het
Drd2 A G 9: 49,404,912 K324R probably benign Het
Ergic1 T C 17: 26,614,358 S29P probably damaging Het
Fmnl1 A G 11: 103,196,512 probably benign Het
Foxd2 C T 4: 114,908,635 A63T unknown Het
Gfap T C 11: 102,891,456 I409M probably benign Het
Gfpt1 A G 6: 87,042,999 M1V probably null Het
H2-T23 C G 17: 36,031,803 E148Q possibly damaging Het
Hip1 G A 5: 135,428,741 R704W probably damaging Het
Kif19a A C 11: 114,779,654 D130A probably damaging Het
Lin7b T C 7: 45,369,193 D14G probably damaging Het
Meioc T A 11: 102,675,257 N510K possibly damaging Het
Mettl5 C A 2: 69,881,319 G68* probably null Het
Mitf A T 6: 98,013,694 I184F probably damaging Het
Mmp9 T A 2: 164,949,050 H119Q probably benign Het
Mycbp2 T A 14: 103,169,910 H2768L probably benign Het
Myh2 A T 11: 67,188,812 I1032F probably benign Het
Myo3b T C 2: 70,314,430 I1110T probably damaging Het
Nde1 T C 16: 14,169,514 F8L probably damaging Het
Olfr1317 T C 2: 112,142,683 V246A possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr432 C T 1: 174,051,287 Q305* probably null Het
Olfr447 A G 6: 42,911,523 probably null Het
Olfr550 A C 7: 102,579,305 Y270S possibly damaging Het
Olfr753-ps1 T C 17: 37,169,917 I244V probably benign Het
Olfr771 T C 10: 129,160,837 D49G possibly damaging Het
Pcdhga8 A G 18: 37,726,770 H293R probably benign Het
Pde7a A T 3: 19,233,773 L244Q probably damaging Het
Pex14 T C 4: 148,961,453 D340G probably benign Het
Pfkfb4 A T 9: 109,008,421 I195F probably damaging Het
Pik3c2a C A 7: 116,405,951 G361W probably damaging Het
Prkcg T A 7: 3,329,081 M517K probably damaging Het
Prob1 A T 18: 35,654,114 F362L probably benign Het
Rims4 C T 2: 163,864,017 W232* probably null Het
Robo2 T C 16: 73,961,819 D688G probably damaging Het
Sec24c C A 14: 20,679,573 A73E probably benign Het
Slc15a3 A G 19: 10,843,210 N64D probably benign Het
Smg1 A T 7: 118,212,559 N65K probably benign Het
Sptb G T 12: 76,587,441 D2165E probably benign Het
Sptbn5 A T 2: 120,048,811 noncoding transcript Het
Syt12 A T 19: 4,456,541 M192K possibly damaging Het
Tas2r107 A G 6: 131,659,708 V126A probably benign Het
Thbs3 T C 3: 89,219,098 L242P probably damaging Het
Timp2 A T 11: 118,317,532 probably null Het
Tmtc1 G A 6: 148,246,831 A751V probably damaging Het
Tnni2 A T 7: 142,443,913 D85V probably damaging Het
Ttc39b G A 4: 83,244,070 P319L probably damaging Het
Ttc6 A T 12: 57,576,019 K68M probably damaging Het
Usp25 G A 16: 77,050,472 R156Q probably benign Het
Vmn1r65 T A 7: 6,009,224 T4S probably benign Het
Vmn2r76 C A 7: 86,226,053 C572F probably damaging Het
Vps26a A C 10: 62,468,298 N181K probably damaging Het
Xirp2 T C 2: 67,510,790 L1125P probably damaging Het
Zbtb41 T G 1: 139,423,763 S205A probably benign Het
Zfp438 T C 18: 5,214,526 D144G probably benign Het
Zfp600 T C 4: 146,195,100 S113P probably damaging Het
Zfp84 C T 7: 29,776,393 T170M probably benign Het
Zmiz2 T A 11: 6,402,837 D654E probably damaging Het
Zswim4 A T 8: 84,231,110 probably null Het
Other mutations in Vill
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Vill APN 9 119063312 missense probably damaging 1.00
IGL01024:Vill APN 9 119070350 critical splice donor site probably null
IGL01934:Vill APN 9 119066809 missense probably damaging 1.00
IGL02118:Vill APN 9 119060398 missense probably benign 0.44
IGL02260:Vill APN 9 119058441 missense probably benign 0.00
IGL02507:Vill APN 9 119070777 missense possibly damaging 0.86
IGL02870:Vill APN 9 119061899 missense probably damaging 1.00
IGL02941:Vill APN 9 119066887 unclassified probably benign
IGL02835:Vill UTSW 9 119067445 missense probably benign 0.11
R0285:Vill UTSW 9 119070827 unclassified probably benign
R0571:Vill UTSW 9 119070633 missense possibly damaging 0.93
R1024:Vill UTSW 9 119066824 missense probably damaging 1.00
R1168:Vill UTSW 9 119070321 missense probably damaging 0.99
R1374:Vill UTSW 9 119061494 missense probably benign 0.03
R1400:Vill UTSW 9 119063347 missense probably benign 0.01
R1551:Vill UTSW 9 119063372 missense probably benign
R1584:Vill UTSW 9 119065586 missense probably damaging 1.00
R1630:Vill UTSW 9 119070701 missense probably benign 0.37
R1721:Vill UTSW 9 119066014 missense probably damaging 0.98
R1946:Vill UTSW 9 119058492 missense probably benign
R2311:Vill UTSW 9 119065897 missense probably benign 0.08
R2392:Vill UTSW 9 119067560 unclassified probably benign
R2509:Vill UTSW 9 119070302 missense possibly damaging 0.84
R2760:Vill UTSW 9 119066882 critical splice donor site probably null
R3886:Vill UTSW 9 119066714 missense probably benign 0.24
R3944:Vill UTSW 9 119068431 missense probably benign 0.10
R4245:Vill UTSW 9 119071291 unclassified probably benign
R4246:Vill UTSW 9 119060393 missense probably damaging 1.00
R4771:Vill UTSW 9 119068434 missense probably damaging 1.00
R4889:Vill UTSW 9 119063341 missense possibly damaging 0.50
R4932:Vill UTSW 9 119061511 missense probably damaging 1.00
R4946:Vill UTSW 9 119068440 missense probably damaging 1.00
R5121:Vill UTSW 9 119070025 missense possibly damaging 0.92
R6089:Vill UTSW 9 119057799 missense probably benign 0.00
R6149:Vill UTSW 9 119058414 missense possibly damaging 0.67
R6167:Vill UTSW 9 119066864 missense probably damaging 0.98
R6318:Vill UTSW 9 119063648 missense probably benign 0.15
R6319:Vill UTSW 9 119063648 missense probably benign 0.15
R6590:Vill UTSW 9 119061907 missense probably benign 0.04
R6690:Vill UTSW 9 119061907 missense probably benign 0.04
R6889:Vill UTSW 9 119065882 missense possibly damaging 0.58
R7207:Vill UTSW 9 119071213 missense possibly damaging 0.64
R7353:Vill UTSW 9 119065493 missense probably damaging 0.99
R7398:Vill UTSW 9 119070648 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AATGAATGACACCTCCGGGATG -3'
(R):5'- AGCAGTCAGAAGGAATCCTTTC -3'

Sequencing Primer
(F):5'- TGGGACAGGAATCTGGGCTC -3'
(R):5'- AAGACGGTGTCCCAGAGTGC -3'
Posted On2016-11-08