Incidental Mutation 'R5646:Zmiz2'
ID441171
Institutional Source Beutler Lab
Gene Symbol Zmiz2
Ensembl Gene ENSMUSG00000041164
Gene Namezinc finger, MIZ-type containing 2
SynonymsZimp7, D11Bwg0280e, 2410117E06Rik
MMRRC Submission 043294-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5646 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6389074-6406158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6402837 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 654 (D654E)
Ref Sequence ENSEMBL: ENSMUSP00000105410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012612] [ENSMUST00000102914] [ENSMUST00000109785] [ENSMUST00000109786] [ENSMUST00000109787]
Predicted Effect probably damaging
Transcript: ENSMUST00000012612
AA Change: D654E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012612
Gene: ENSMUSG00000041164
AA Change: D654E

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
Pfam:zf-MIZ 596 645 1.7e-26 PFAM
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102914
AA Change: D622E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099978
Gene: ENSMUSG00000041164
AA Change: D622E

DomainStartEndE-ValueType
low complexity region 89 102 N/A INTRINSIC
low complexity region 115 138 N/A INTRINSIC
low complexity region 171 195 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 241 252 N/A INTRINSIC
low complexity region 257 275 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
Pfam:zf-Nse 556 611 3.8e-8 PFAM
Pfam:zf-MIZ 564 613 5.4e-26 PFAM
low complexity region 689 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109785
AA Change: D628E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105408
Gene: ENSMUSG00000041164
AA Change: D628E

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 340 359 N/A INTRINSIC
Pfam:zf-Nse 562 617 3.8e-8 PFAM
Pfam:zf-MIZ 570 619 5.4e-26 PFAM
low complexity region 695 710 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109786
AA Change: D654E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105409
Gene: ENSMUSG00000041164
AA Change: D654E

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
Pfam:zf-Nse 588 643 4e-8 PFAM
Pfam:zf-MIZ 596 645 5.6e-26 PFAM
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109787
AA Change: D654E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105410
Gene: ENSMUSG00000041164
AA Change: D654E

DomainStartEndE-ValueType
low complexity region 60 82 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 147 170 N/A INTRINSIC
low complexity region 203 227 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
Pfam:zf-Nse 588 643 4e-8 PFAM
Pfam:zf-MIZ 596 645 5.6e-26 PFAM
low complexity region 721 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184154
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZMIZ2 and ZMIZ1 (MIM 607159) are members of a PIAS (see MIM 603566)-like family of proteins that interact with nuclear hormone receptors. ZMIZ2 interacts with androgen receptor (AR; MIM 313700) and enhances AR-mediated transcription (Huang et al., 2005 [PubMed 16051670]).[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,776 S4467P probably damaging Het
Add1 C A 5: 34,630,680 A691D probably benign Het
Agap3 C A 5: 24,483,397 D394E probably benign Het
Arhgef11 T C 3: 87,684,486 V59A possibly damaging Het
Atp2a1 A G 7: 126,453,105 V402A probably benign Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Bsn A T 9: 108,110,432 probably benign Het
Camk1 A G 6: 113,339,340 V81A probably damaging Het
Cass4 T G 2: 172,416,245 C54W probably damaging Het
Ccdc39 A T 3: 33,825,550 F456L probably damaging Het
Cdc42bpa A G 1: 180,106,094 E766G probably damaging Het
Cdcp2 T C 4: 107,105,142 C171R probably damaging Het
Cdh9 G A 15: 16,823,285 E118K probably damaging Het
Col4a2 G A 8: 11,441,281 G1227R probably damaging Het
Cyp2d9 A G 15: 82,452,464 T5A probably benign Het
Dlg5 T A 14: 24,158,699 D813V probably damaging Het
Dmtf1 G A 5: 9,124,515 S405F possibly damaging Het
Drd2 A G 9: 49,404,912 K324R probably benign Het
Ergic1 T C 17: 26,614,358 S29P probably damaging Het
Fmnl1 A G 11: 103,196,512 probably benign Het
Foxd2 C T 4: 114,908,635 A63T unknown Het
Gfap T C 11: 102,891,456 I409M probably benign Het
Gfpt1 A G 6: 87,042,999 M1V probably null Het
H2-T23 C G 17: 36,031,803 E148Q possibly damaging Het
Hip1 G A 5: 135,428,741 R704W probably damaging Het
Kif19a A C 11: 114,779,654 D130A probably damaging Het
Lin7b T C 7: 45,369,193 D14G probably damaging Het
Meioc T A 11: 102,675,257 N510K possibly damaging Het
Mettl5 C A 2: 69,881,319 G68* probably null Het
Mitf A T 6: 98,013,694 I184F probably damaging Het
Mmp9 T A 2: 164,949,050 H119Q probably benign Het
Mycbp2 T A 14: 103,169,910 H2768L probably benign Het
Myh2 A T 11: 67,188,812 I1032F probably benign Het
Myo3b T C 2: 70,314,430 I1110T probably damaging Het
Nde1 T C 16: 14,169,514 F8L probably damaging Het
Olfr1317 T C 2: 112,142,683 V246A possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr432 C T 1: 174,051,287 Q305* probably null Het
Olfr447 A G 6: 42,911,523 probably null Het
Olfr550 A C 7: 102,579,305 Y270S possibly damaging Het
Olfr753-ps1 T C 17: 37,169,917 I244V probably benign Het
Olfr771 T C 10: 129,160,837 D49G possibly damaging Het
Pcdhga8 A G 18: 37,726,770 H293R probably benign Het
Pde7a A T 3: 19,233,773 L244Q probably damaging Het
Pex14 T C 4: 148,961,453 D340G probably benign Het
Pfkfb4 A T 9: 109,008,421 I195F probably damaging Het
Pik3c2a C A 7: 116,405,951 G361W probably damaging Het
Prkcg T A 7: 3,329,081 M517K probably damaging Het
Prob1 A T 18: 35,654,114 F362L probably benign Het
Rims4 C T 2: 163,864,017 W232* probably null Het
Robo2 T C 16: 73,961,819 D688G probably damaging Het
Sec24c C A 14: 20,679,573 A73E probably benign Het
Slc15a3 A G 19: 10,843,210 N64D probably benign Het
Smg1 A T 7: 118,212,559 N65K probably benign Het
Sptb G T 12: 76,587,441 D2165E probably benign Het
Sptbn5 A T 2: 120,048,811 noncoding transcript Het
Syt12 A T 19: 4,456,541 M192K possibly damaging Het
Tas2r107 A G 6: 131,659,708 V126A probably benign Het
Thbs3 T C 3: 89,219,098 L242P probably damaging Het
Timp2 A T 11: 118,317,532 probably null Het
Tmtc1 G A 6: 148,246,831 A751V probably damaging Het
Tnni2 A T 7: 142,443,913 D85V probably damaging Het
Ttc39b G A 4: 83,244,070 P319L probably damaging Het
Ttc6 A T 12: 57,576,019 K68M probably damaging Het
Usp25 G A 16: 77,050,472 R156Q probably benign Het
Vill A T 9: 119,071,162 D365V probably damaging Het
Vmn1r65 T A 7: 6,009,224 T4S probably benign Het
Vmn2r76 C A 7: 86,226,053 C572F probably damaging Het
Vps26a A C 10: 62,468,298 N181K probably damaging Het
Xirp2 T C 2: 67,510,790 L1125P probably damaging Het
Zbtb41 T G 1: 139,423,763 S205A probably benign Het
Zfp438 T C 18: 5,214,526 D144G probably benign Het
Zfp600 T C 4: 146,195,100 S113P probably damaging Het
Zfp84 C T 7: 29,776,393 T170M probably benign Het
Zswim4 A T 8: 84,231,110 probably null Het
Other mutations in Zmiz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zmiz2 APN 11 6402845 missense probably damaging 0.98
IGL01345:Zmiz2 APN 11 6405015 missense possibly damaging 0.96
IGL01382:Zmiz2 APN 11 6403781 splice site probably null
IGL02942:Zmiz2 APN 11 6399500 splice site probably benign
IGL03156:Zmiz2 APN 11 6399536 missense probably damaging 1.00
IGL03301:Zmiz2 APN 11 6401170 missense probably damaging 1.00
P0037:Zmiz2 UTSW 11 6403885 missense probably damaging 1.00
R0938:Zmiz2 UTSW 11 6397185 missense probably benign
R1666:Zmiz2 UTSW 11 6396836 missense probably benign 0.00
R1692:Zmiz2 UTSW 11 6400795 missense probably damaging 1.00
R4877:Zmiz2 UTSW 11 6403251 missense probably damaging 1.00
R5375:Zmiz2 UTSW 11 6397519 nonsense probably null
R5783:Zmiz2 UTSW 11 6405081 missense probably damaging 1.00
R5875:Zmiz2 UTSW 11 6405072 missense probably damaging 1.00
R6276:Zmiz2 UTSW 11 6395604 unclassified probably null
R6962:Zmiz2 UTSW 11 6402455 missense probably damaging 1.00
R6974:Zmiz2 UTSW 11 6397566 nonsense probably null
R6983:Zmiz2 UTSW 11 6402413 missense probably damaging 1.00
R7271:Zmiz2 UTSW 11 6399593 missense probably damaging 1.00
Z1088:Zmiz2 UTSW 11 6399603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCTTTGCATAGCATCCC -3'
(R):5'- CACTCATCAGATGCGCAGTAG -3'

Sequencing Primer
(F):5'- TCACACTGGACTGCCATAGTG -3'
(R):5'- TAGACACTGGCCTGGAGTG -3'
Posted On2016-11-08