Incidental Mutation 'R5646:Syt12'
ID441197
Institutional Source Beutler Lab
Gene Symbol Syt12
Ensembl Gene ENSMUSG00000049303
Gene Namesynaptotagmin XII
Synonyms
MMRRC Submission 043294-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5646 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4445908-4477447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4456541 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 192 (M192K)
Ref Sequence ENSEMBL: ENSMUSP00000055237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059295] [ENSMUST00000166191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059295
AA Change: M192K

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055237
Gene: ENSMUSG00000049303
AA Change: M192K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
C2 168 272 1.8e-6 SMART
C2 299 405 4.9e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128114
Predicted Effect probably benign
Transcript: ENSMUST00000166191
SMART Domains Protein: ENSMUSP00000130418
Gene: ENSMUSG00000049303

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown that the encoded protein selectively modulates spontaneous synaptic-vesicle exocytosis and may also be involved in regulating calcium independent secretion in nonneuronal cells. Alternative splicing results in multiple transcript variants. The gene has previously been referred to as synaptotagmin XI but has been renamed synaptotagmin XII to be standard with mouse and rat official nomenclature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,776 S4467P probably damaging Het
Add1 C A 5: 34,630,680 A691D probably benign Het
Agap3 C A 5: 24,483,397 D394E probably benign Het
Arhgef11 T C 3: 87,684,486 V59A possibly damaging Het
Atp2a1 A G 7: 126,453,105 V402A probably benign Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Bsn A T 9: 108,110,432 probably benign Het
Camk1 A G 6: 113,339,340 V81A probably damaging Het
Cass4 T G 2: 172,416,245 C54W probably damaging Het
Ccdc39 A T 3: 33,825,550 F456L probably damaging Het
Cdc42bpa A G 1: 180,106,094 E766G probably damaging Het
Cdcp2 T C 4: 107,105,142 C171R probably damaging Het
Cdh9 G A 15: 16,823,285 E118K probably damaging Het
Col4a2 G A 8: 11,441,281 G1227R probably damaging Het
Cyp2d9 A G 15: 82,452,464 T5A probably benign Het
Dlg5 T A 14: 24,158,699 D813V probably damaging Het
Dmtf1 G A 5: 9,124,515 S405F possibly damaging Het
Drd2 A G 9: 49,404,912 K324R probably benign Het
Ergic1 T C 17: 26,614,358 S29P probably damaging Het
Fmnl1 A G 11: 103,196,512 probably benign Het
Foxd2 C T 4: 114,908,635 A63T unknown Het
Gfap T C 11: 102,891,456 I409M probably benign Het
Gfpt1 A G 6: 87,042,999 M1V probably null Het
H2-T23 C G 17: 36,031,803 E148Q possibly damaging Het
Hip1 G A 5: 135,428,741 R704W probably damaging Het
Kif19a A C 11: 114,779,654 D130A probably damaging Het
Lin7b T C 7: 45,369,193 D14G probably damaging Het
Meioc T A 11: 102,675,257 N510K possibly damaging Het
Mettl5 C A 2: 69,881,319 G68* probably null Het
Mitf A T 6: 98,013,694 I184F probably damaging Het
Mmp9 T A 2: 164,949,050 H119Q probably benign Het
Mycbp2 T A 14: 103,169,910 H2768L probably benign Het
Myh2 A T 11: 67,188,812 I1032F probably benign Het
Myo3b T C 2: 70,314,430 I1110T probably damaging Het
Nde1 T C 16: 14,169,514 F8L probably damaging Het
Olfr1317 T C 2: 112,142,683 V246A possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr432 C T 1: 174,051,287 Q305* probably null Het
Olfr447 A G 6: 42,911,523 probably null Het
Olfr550 A C 7: 102,579,305 Y270S possibly damaging Het
Olfr753-ps1 T C 17: 37,169,917 I244V probably benign Het
Olfr771 T C 10: 129,160,837 D49G possibly damaging Het
Pcdhga8 A G 18: 37,726,770 H293R probably benign Het
Pde7a A T 3: 19,233,773 L244Q probably damaging Het
Pex14 T C 4: 148,961,453 D340G probably benign Het
Pfkfb4 A T 9: 109,008,421 I195F probably damaging Het
Pik3c2a C A 7: 116,405,951 G361W probably damaging Het
Prkcg T A 7: 3,329,081 M517K probably damaging Het
Prob1 A T 18: 35,654,114 F362L probably benign Het
Rims4 C T 2: 163,864,017 W232* probably null Het
Robo2 T C 16: 73,961,819 D688G probably damaging Het
Sec24c C A 14: 20,679,573 A73E probably benign Het
Slc15a3 A G 19: 10,843,210 N64D probably benign Het
Smg1 A T 7: 118,212,559 N65K probably benign Het
Sptb G T 12: 76,587,441 D2165E probably benign Het
Sptbn5 A T 2: 120,048,811 noncoding transcript Het
Tas2r107 A G 6: 131,659,708 V126A probably benign Het
Thbs3 T C 3: 89,219,098 L242P probably damaging Het
Timp2 A T 11: 118,317,532 probably null Het
Tmtc1 G A 6: 148,246,831 A751V probably damaging Het
Tnni2 A T 7: 142,443,913 D85V probably damaging Het
Ttc39b G A 4: 83,244,070 P319L probably damaging Het
Ttc6 A T 12: 57,576,019 K68M probably damaging Het
Usp25 G A 16: 77,050,472 R156Q probably benign Het
Vill A T 9: 119,071,162 D365V probably damaging Het
Vmn1r65 T A 7: 6,009,224 T4S probably benign Het
Vmn2r76 C A 7: 86,226,053 C572F probably damaging Het
Vps26a A C 10: 62,468,298 N181K probably damaging Het
Xirp2 T C 2: 67,510,790 L1125P probably damaging Het
Zbtb41 T G 1: 139,423,763 S205A probably benign Het
Zfp438 T C 18: 5,214,526 D144G probably benign Het
Zfp600 T C 4: 146,195,100 S113P probably damaging Het
Zfp84 C T 7: 29,776,393 T170M probably benign Het
Zmiz2 T A 11: 6,402,837 D654E probably damaging Het
Zswim4 A T 8: 84,231,110 probably null Het
Other mutations in Syt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt12 APN 19 4447845 missense probably damaging 0.99
IGL02045:Syt12 APN 19 4447734 missense probably damaging 1.00
IGL02942:Syt12 APN 19 4447830 missense probably benign 0.16
IGL03131:Syt12 APN 19 4456854 missense probably benign
R1308:Syt12 UTSW 19 4460735 missense probably damaging 0.99
R1830:Syt12 UTSW 19 4456883 missense probably benign
R1858:Syt12 UTSW 19 4447797 missense probably damaging 1.00
R4192:Syt12 UTSW 19 4447681 utr 3 prime probably benign
R5769:Syt12 UTSW 19 4451044 missense probably damaging 1.00
R5785:Syt12 UTSW 19 4450994 missense possibly damaging 0.95
R6079:Syt12 UTSW 19 4456868 missense probably benign
R7017:Syt12 UTSW 19 4460867 intron probably null
R7043:Syt12 UTSW 19 4451021 missense probably benign 0.04
R7137:Syt12 UTSW 19 4453950 missense probably damaging 1.00
R8042:Syt12 UTSW 19 4453824 missense probably damaging 0.98
U15987:Syt12 UTSW 19 4456868 missense probably benign
Z1177:Syt12 UTSW 19 4453928 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGCTGGTTCTAGGCATAGC -3'
(R):5'- GAAAGTCACAGTCGGCTGAC -3'

Sequencing Primer
(F):5'- GCATAGCCATCCTACTCTGAATC -3'
(R):5'- GTCGGCTGACTCTCTGAATTC -3'
Posted On2016-11-08