Incidental Mutation 'R5647:Plcg1'
ID441205
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Namephospholipase C, gamma 1
SynonymsCded, Plc-gamma1, Plcg-1, Plc-1
MMRRC Submission 043295-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5647 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160731300-160775760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160751668 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 251 (L251P)
Ref Sequence ENSEMBL: ENSMUSP00000105088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590] [ENSMUST00000174885]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000017077
Predicted Effect probably benign
Transcript: ENSMUST00000103115
AA Change: L251P

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: L251P

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109462
AA Change: L251P

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: L251P

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147254
Predicted Effect probably benign
Transcript: ENSMUST00000151590
AA Change: L251P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933
AA Change: L251P

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173791
Predicted Effect probably benign
Transcript: ENSMUST00000174885
SMART Domains Protein: ENSMUSP00000134720
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
SCOP:d1mai__ 27 110 2e-16 SMART
Blast:PH 28 110 6e-53 BLAST
Meta Mutation Damage Score 0.6036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T C 7: 82,856,398 noncoding transcript Het
9330159F19Rik A T 10: 29,225,254 D541V probably damaging Het
9930021J03Rik A G 19: 29,753,810 S601P possibly damaging Het
Abcc5 T C 16: 20,399,847 I262V probably damaging Het
Acvr1c T A 2: 58,295,964 D169V probably damaging Het
Aldh16a1 A G 7: 45,154,465 V6A probably benign Het
Cd36 A C 5: 17,814,765 S113A probably damaging Het
Cdt1 G T 8: 122,570,208 R247L possibly damaging Het
Ces4a G A 8: 105,146,080 V322M probably benign Het
Cngb3 A T 4: 19,364,266 T157S possibly damaging Het
Cpped1 T C 16: 11,828,146 probably benign Het
Ctr9 G T 7: 111,055,544 R1094L unknown Het
Cyld A T 8: 88,734,926 I664L probably benign Het
Dvl2 C T 11: 70,009,449 P690S possibly damaging Het
Fbxo7 A C 10: 86,029,110 E94D probably damaging Het
Fstl5 A C 3: 76,589,092 K387N probably damaging Het
Gm884 T C 11: 103,617,474 probably benign Het
Gm9845 A C 3: 39,358,371 noncoding transcript Het
Hk1 T C 10: 62,275,744 D746G probably damaging Het
Lmbr1 A G 5: 29,263,393 probably null Het
Lrp2 C T 2: 69,519,914 A705T probably null Het
Mybpc3 A G 2: 91,121,722 probably null Het
Myo15b T A 11: 115,871,511 L1219Q probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr1279 G T 2: 111,307,047 A281S possibly damaging Het
Olfr1465 A T 19: 13,314,189 I32N probably damaging Het
Olfr1467 T C 19: 13,365,177 V183A probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcnt T C 10: 76,385,841 T1984A probably benign Het
Plin1 T A 7: 79,721,572 D468V probably benign Het
Pmp2 A G 3: 10,183,785 V12A probably benign Het
Rnf19a T A 15: 36,265,963 probably benign Het
Rnf214 G A 9: 45,868,046 Q469* probably null Het
Rrp1b T G 17: 32,056,011 probably benign Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sema3e A T 5: 14,225,553 E224V probably damaging Het
Sphkap A G 1: 83,407,999 S5P probably damaging Het
Stab1 A C 14: 31,157,440 Y694* probably null Het
Stambpl1 T C 19: 34,234,286 L249P probably benign Het
Thap4 A T 1: 93,714,943 H515Q probably damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Uaca A G 9: 60,872,098 R1256G probably benign Het
Usp17lb T A 7: 104,840,674 N348Y possibly damaging Het
Vmn1r42 A G 6: 89,845,332 I85T probably benign Het
Vps9d1 A T 8: 123,248,859 L149Q probably damaging Het
Zdhhc17 A T 10: 110,973,833 I153N probably damaging Het
Zfp207 G A 11: 80,393,133 S293N possibly damaging Het
Zfp346 A G 13: 55,122,357 D198G probably damaging Het
Zfp953 A T 13: 67,343,472 C139S possibly damaging Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160757266 missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160758083 missense probably benign 0.03
IGL01066:Plcg1 APN 2 160754398 missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160753893 missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160758010 missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160747779 missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160761433 missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160753926 missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160753507 missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160755752 nonsense probably null
IGL03096:Plcg1 APN 2 160757206 splice site probably benign
IGL03129:Plcg1 APN 2 160774526 critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160748129 critical splice donor site probably null
IGL03211:Plcg1 APN 2 160759691 missense possibly damaging 0.82
suscepit UTSW 2 160753602 intron probably null
IGL03047:Plcg1 UTSW 2 160754879 missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160732000 missense probably damaging 1.00
R0390:Plcg1 UTSW 2 160752366 missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160761429 missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160753363 splice site probably benign
R0679:Plcg1 UTSW 2 160756910 missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160751778 splice site probably null
R1719:Plcg1 UTSW 2 160753743 missense probably null 0.94
R1721:Plcg1 UTSW 2 160731920 missense probably damaging 0.99
R1727:Plcg1 UTSW 2 160748088 missense probably benign 0.00
R1978:Plcg1 UTSW 2 160752578 unclassified probably null
R2277:Plcg1 UTSW 2 160755805 missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160754437 missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160747841 missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160751707 critical splice donor site probably null
R4622:Plcg1 UTSW 2 160747768 splice site probably benign
R4837:Plcg1 UTSW 2 160750986 missense probably benign 0.00
R4942:Plcg1 UTSW 2 160753589 intron probably null
R5514:Plcg1 UTSW 2 160753355 critical splice donor site probably null
R5929:Plcg1 UTSW 2 160753602 intron probably null
R6303:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6304:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160753710 missense probably benign 0.10
R6500:Plcg1 UTSW 2 160754567 missense probably damaging 1.00
R7017:Plcg1 UTSW 2 160758097 missense probably damaging 1.00
R7113:Plcg1 UTSW 2 160748283 missense possibly damaging 0.78
R7137:Plcg1 UTSW 2 160753926 missense possibly damaging 0.83
R7155:Plcg1 UTSW 2 160754380 missense probably damaging 1.00
R7211:Plcg1 UTSW 2 160731874 missense probably benign 0.02
R7777:Plcg1 UTSW 2 160754603 missense possibly damaging 0.89
Z1176:Plcg1 UTSW 2 160758127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTTCCCTTCTTGGAAAC -3'
(R):5'- AAGGAAGCTGAGCATGAATTCC -3'

Sequencing Primer
(F):5'- CTTCTTGGAAACCAACGCTTTGAGG -3'
(R):5'- ATGAATTCCTGCACCTGGAG -3'
Posted On2016-11-08