Incidental Mutation 'R5647:Zdhhc17'
ID441230
Institutional Source Beutler Lab
Gene Symbol Zdhhc17
Ensembl Gene ENSMUSG00000035798
Gene Namezinc finger, DHHC domain containing 17
SynonymsHip14, A230053P19Rik, D130071N24Rik
MMRRC Submission 043295-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5647 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location110941780-111010140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110973833 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 153 (I153N)
Ref Sequence ENSEMBL: ENSMUSP00000043279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041723] [ENSMUST00000219307]
Predicted Effect probably damaging
Transcript: ENSMUST00000041723
AA Change: I153N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043279
Gene: ENSMUSG00000035798
AA Change: I153N

DomainStartEndE-ValueType
Blast:ANK 57 85 2e-8 BLAST
ANK 89 118 6.71e-2 SMART
ANK 123 152 1.99e-4 SMART
ANK 156 185 1.61e-4 SMART
ANK 189 219 1.9e-1 SMART
ANK 224 253 1.53e-5 SMART
Blast:ANK 257 286 2e-11 BLAST
transmembrane domain 305 323 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 384 403 N/A INTRINSIC
Pfam:zf-DHHC 434 570 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099285
SMART Domains Protein: ENSMUSP00000096889
Gene: ENSMUSG00000035798

DomainStartEndE-ValueType
ANK 79 108 6.71e-2 SMART
ANK 113 142 1.99e-4 SMART
ANK 146 175 1.61e-4 SMART
ANK 179 209 1.9e-1 SMART
ANK 214 243 1.53e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218981
Predicted Effect probably benign
Transcript: ENSMUST00000219307
AA Change: I15N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect unknown
Transcript: ENSMUST00000220247
AA Change: I141N
Meta Mutation Damage Score 0.1014 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 95% (55/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reminiscent of Huntington disease (decreased body weight, impaired coordination, hyperactivity, increased rearing, decreased prepulse inhibition, increased stereotypic behavior, reduced striatum, and decreased brain weight). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T C 7: 82,856,398 noncoding transcript Het
9330159F19Rik A T 10: 29,225,254 D541V probably damaging Het
9930021J03Rik A G 19: 29,753,810 S601P possibly damaging Het
Abcc5 T C 16: 20,399,847 I262V probably damaging Het
Acvr1c T A 2: 58,295,964 D169V probably damaging Het
Aldh16a1 A G 7: 45,154,465 V6A probably benign Het
Cd36 A C 5: 17,814,765 S113A probably damaging Het
Cdt1 G T 8: 122,570,208 R247L possibly damaging Het
Ces4a G A 8: 105,146,080 V322M probably benign Het
Cngb3 A T 4: 19,364,266 T157S possibly damaging Het
Cpped1 T C 16: 11,828,146 probably benign Het
Ctr9 G T 7: 111,055,544 R1094L unknown Het
Cyld A T 8: 88,734,926 I664L probably benign Het
Dvl2 C T 11: 70,009,449 P690S possibly damaging Het
Fbxo7 A C 10: 86,029,110 E94D probably damaging Het
Fstl5 A C 3: 76,589,092 K387N probably damaging Het
Gm884 T C 11: 103,617,474 probably benign Het
Gm9845 A C 3: 39,358,371 noncoding transcript Het
Hk1 T C 10: 62,275,744 D746G probably damaging Het
Lmbr1 A G 5: 29,263,393 probably null Het
Lrp2 C T 2: 69,519,914 A705T probably null Het
Mybpc3 A G 2: 91,121,722 probably null Het
Myo15b T A 11: 115,871,511 L1219Q probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr1279 G T 2: 111,307,047 A281S possibly damaging Het
Olfr1465 A T 19: 13,314,189 I32N probably damaging Het
Olfr1467 T C 19: 13,365,177 V183A probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcnt T C 10: 76,385,841 T1984A probably benign Het
Plcg1 T C 2: 160,751,668 L251P probably benign Het
Plin1 T A 7: 79,721,572 D468V probably benign Het
Pmp2 A G 3: 10,183,785 V12A probably benign Het
Rnf19a T A 15: 36,265,963 probably benign Het
Rnf214 G A 9: 45,868,046 Q469* probably null Het
Rrp1b T G 17: 32,056,011 probably benign Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sema3e A T 5: 14,225,553 E224V probably damaging Het
Sphkap A G 1: 83,407,999 S5P probably damaging Het
Stab1 A C 14: 31,157,440 Y694* probably null Het
Stambpl1 T C 19: 34,234,286 L249P probably benign Het
Thap4 A T 1: 93,714,943 H515Q probably damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Uaca A G 9: 60,872,098 R1256G probably benign Het
Usp17lb T A 7: 104,840,674 N348Y possibly damaging Het
Vmn1r42 A G 6: 89,845,332 I85T probably benign Het
Vps9d1 A T 8: 123,248,859 L149Q probably damaging Het
Zfp207 G A 11: 80,393,133 S293N possibly damaging Het
Zfp346 A G 13: 55,122,357 D198G probably damaging Het
Zfp953 A T 13: 67,343,472 C139S possibly damaging Het
Other mutations in Zdhhc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Zdhhc17 APN 10 110946193 missense probably damaging 1.00
IGL01812:Zdhhc17 APN 10 110948217 missense possibly damaging 0.93
IGL01948:Zdhhc17 APN 10 110946276 missense possibly damaging 0.56
IGL02002:Zdhhc17 APN 10 110967689 missense probably benign
IGL03263:Zdhhc17 APN 10 110961016 missense probably damaging 1.00
R0153:Zdhhc17 UTSW 10 110955094 nonsense probably null
R0375:Zdhhc17 UTSW 10 110982106 nonsense probably null
R0436:Zdhhc17 UTSW 10 110981990 splice site probably null
R1452:Zdhhc17 UTSW 10 110955075 missense probably benign 0.04
R1496:Zdhhc17 UTSW 10 110946210 missense probably damaging 0.99
R1528:Zdhhc17 UTSW 10 110948189 critical splice donor site probably null
R1856:Zdhhc17 UTSW 10 110947293 splice site probably null
R2119:Zdhhc17 UTSW 10 110982048 missense possibly damaging 0.92
R3747:Zdhhc17 UTSW 10 110944420 missense probably benign 0.24
R4900:Zdhhc17 UTSW 10 110985958 missense possibly damaging 0.95
R5758:Zdhhc17 UTSW 10 110944395 makesense probably null
R6228:Zdhhc17 UTSW 10 110956355 missense probably benign 0.01
R6823:Zdhhc17 UTSW 10 110955111 missense possibly damaging 0.91
R7172:Zdhhc17 UTSW 10 111009948 missense possibly damaging 0.82
R7874:Zdhhc17 UTSW 10 110982117 missense possibly damaging 0.93
Z1088:Zdhhc17 UTSW 10 110945466 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCTCCTCCATCAGAAACTACT -3'
(R):5'- CTCCTGTGTCTTGTTTTAAAGCAAC -3'

Sequencing Primer
(F):5'- TCCTCCATCAGAAACTACTACTTAAG -3'
(R):5'- GCAACTTGATAAAATGTGTGCTTTG -3'
Posted On2016-11-08