Incidental Mutation 'R5647:Rrp1b'
ID441245
Institutional Source Beutler Lab
Gene Symbol Rrp1b
Ensembl Gene ENSMUSG00000058392
Gene Nameribosomal RNA processing 1 homolog B (S. cerevisiae)
Synonyms
MMRRC Submission 043295-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5647 (G1)
Quality Score194
Status Validated
Chromosome17
Chromosomal Location32036100-32062865 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 32056011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081339] [ENSMUST00000150469]
Predicted Effect probably benign
Transcript: ENSMUST00000081339
SMART Domains Protein: ENSMUSP00000080085
Gene: ENSMUSG00000058392

DomainStartEndE-ValueType
Pfam:Nop52 10 218 3.3e-73 PFAM
low complexity region 344 352 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 450 463 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150469
SMART Domains Protein: ENSMUSP00000117400
Gene: ENSMUSG00000058392

DomainStartEndE-ValueType
low complexity region 96 107 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T C 7: 82,856,398 noncoding transcript Het
9330159F19Rik A T 10: 29,225,254 D541V probably damaging Het
9930021J03Rik A G 19: 29,753,810 S601P possibly damaging Het
Abcc5 T C 16: 20,399,847 I262V probably damaging Het
Acvr1c T A 2: 58,295,964 D169V probably damaging Het
Aldh16a1 A G 7: 45,154,465 V6A probably benign Het
Cd36 A C 5: 17,814,765 S113A probably damaging Het
Cdt1 G T 8: 122,570,208 R247L possibly damaging Het
Ces4a G A 8: 105,146,080 V322M probably benign Het
Cngb3 A T 4: 19,364,266 T157S possibly damaging Het
Cpped1 T C 16: 11,828,146 probably benign Het
Ctr9 G T 7: 111,055,544 R1094L unknown Het
Cyld A T 8: 88,734,926 I664L probably benign Het
Dvl2 C T 11: 70,009,449 P690S possibly damaging Het
Fbxo7 A C 10: 86,029,110 E94D probably damaging Het
Fstl5 A C 3: 76,589,092 K387N probably damaging Het
Gm884 T C 11: 103,617,474 probably benign Het
Gm9845 A C 3: 39,358,371 noncoding transcript Het
Hk1 T C 10: 62,275,744 D746G probably damaging Het
Lmbr1 A G 5: 29,263,393 probably null Het
Lrp2 C T 2: 69,519,914 A705T probably null Het
Mybpc3 A G 2: 91,121,722 probably null Het
Myo15b T A 11: 115,871,511 L1219Q probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr1279 G T 2: 111,307,047 A281S possibly damaging Het
Olfr1465 A T 19: 13,314,189 I32N probably damaging Het
Olfr1467 T C 19: 13,365,177 V183A probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcnt T C 10: 76,385,841 T1984A probably benign Het
Plcg1 T C 2: 160,751,668 L251P probably benign Het
Plin1 T A 7: 79,721,572 D468V probably benign Het
Pmp2 A G 3: 10,183,785 V12A probably benign Het
Rnf19a T A 15: 36,265,963 probably benign Het
Rnf214 G A 9: 45,868,046 Q469* probably null Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sema3e A T 5: 14,225,553 E224V probably damaging Het
Sphkap A G 1: 83,407,999 S5P probably damaging Het
Stab1 A C 14: 31,157,440 Y694* probably null Het
Stambpl1 T C 19: 34,234,286 L249P probably benign Het
Thap4 A T 1: 93,714,943 H515Q probably damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Uaca A G 9: 60,872,098 R1256G probably benign Het
Usp17lb T A 7: 104,840,674 N348Y possibly damaging Het
Vmn1r42 A G 6: 89,845,332 I85T probably benign Het
Vps9d1 A T 8: 123,248,859 L149Q probably damaging Het
Zdhhc17 A T 10: 110,973,833 I153N probably damaging Het
Zfp207 G A 11: 80,393,133 S293N possibly damaging Het
Zfp346 A G 13: 55,122,357 D198G probably damaging Het
Zfp953 A T 13: 67,343,472 C139S possibly damaging Het
Other mutations in Rrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Rrp1b APN 17 32052819 missense probably benign 0.09
IGL01383:Rrp1b APN 17 32058578 missense probably damaging 0.99
IGL02740:Rrp1b APN 17 32059331 missense probably damaging 1.00
IGL03030:Rrp1b APN 17 32056901 missense probably damaging 1.00
IGL03181:Rrp1b APN 17 32057176 missense probably benign 0.13
IGL03396:Rrp1b APN 17 32057263 splice site probably benign
IGL02980:Rrp1b UTSW 17 32050039 missense possibly damaging 0.49
R0138:Rrp1b UTSW 17 32060452 missense probably benign 0.24
R0394:Rrp1b UTSW 17 32058564 missense probably benign 0.34
R0681:Rrp1b UTSW 17 32060395 missense probably damaging 1.00
R1315:Rrp1b UTSW 17 32056639 missense probably benign 0.00
R1351:Rrp1b UTSW 17 32056637 missense possibly damaging 0.82
R1700:Rrp1b UTSW 17 32057204 missense probably benign 0.19
R1815:Rrp1b UTSW 17 32056811 missense probably benign
R1940:Rrp1b UTSW 17 32056845 missense possibly damaging 0.95
R2176:Rrp1b UTSW 17 32056560 missense probably benign 0.00
R2352:Rrp1b UTSW 17 32059328 missense possibly damaging 0.71
R2975:Rrp1b UTSW 17 32058573 missense probably damaging 1.00
R4552:Rrp1b UTSW 17 32056010 splice site probably benign
R5114:Rrp1b UTSW 17 32036471 utr 5 prime probably benign
R5242:Rrp1b UTSW 17 32051703 missense possibly damaging 0.82
R5739:Rrp1b UTSW 17 32045976 missense probably damaging 1.00
R5853:Rrp1b UTSW 17 32056684 missense possibly damaging 0.49
R5878:Rrp1b UTSW 17 32047675 missense probably damaging 1.00
R6389:Rrp1b UTSW 17 32056627 missense possibly damaging 0.55
R6734:Rrp1b UTSW 17 32055304 intron probably benign
R6742:Rrp1b UTSW 17 32056934 missense probably benign
R6759:Rrp1b UTSW 17 32057089 missense probably benign 0.01
R6855:Rrp1b UTSW 17 32052745 missense probably benign 0.00
R7014:Rrp1b UTSW 17 32049427 missense probably damaging 1.00
R7315:Rrp1b UTSW 17 32058571 missense probably benign 0.03
R7689:Rrp1b UTSW 17 32055926 missense probably benign 0.38
R7834:Rrp1b UTSW 17 32051724 missense probably benign 0.00
R7917:Rrp1b UTSW 17 32051724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCCACCAGTCACTGTCC -3'
(R):5'- CAGTGTCTGCAGAGGAAATGAC -3'

Sequencing Primer
(F):5'- CTAAGTCAGGCTCAGCAGTCTTAG -3'
(R):5'- TCTGCAGAGGAAATGACAGAACCC -3'
Posted On2016-11-08