Incidental Mutation 'R5648:Slc4a1ap'
ID441263
Institutional Source Beutler Lab
Gene Symbol Slc4a1ap
Ensembl Gene ENSMUSG00000029141
Gene Namesolute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonymskanadaptin
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31526995-31556932 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 31550785 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114533] [ENSMUST00000202214] [ENSMUST00000202214] [ENSMUST00000202950] [ENSMUST00000202950]
Predicted Effect probably null
Transcript: ENSMUST00000114533
SMART Domains Protein: ENSMUSP00000110179
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117262
SMART Domains Protein: ENSMUSP00000112619
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201789
Predicted Effect probably null
Transcript: ENSMUST00000201789
Predicted Effect probably null
Transcript: ENSMUST00000201925
Predicted Effect probably null
Transcript: ENSMUST00000201925
Predicted Effect probably null
Transcript: ENSMUST00000202214
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202214
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202273
Predicted Effect probably null
Transcript: ENSMUST00000202273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202575
Predicted Effect probably null
Transcript: ENSMUST00000202950
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202950
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Slc4a1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Slc4a1ap APN 5 31553777 missense probably damaging 1.00
IGL01526:Slc4a1ap APN 5 31528227 missense possibly damaging 0.86
R1556:Slc4a1ap UTSW 5 31534210 splice site probably null
R1694:Slc4a1ap UTSW 5 31543754 missense probably damaging 1.00
R1884:Slc4a1ap UTSW 5 31534180 missense probably damaging 1.00
R3787:Slc4a1ap UTSW 5 31528139 missense possibly damaging 0.92
R4510:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4511:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4562:Slc4a1ap UTSW 5 31532029 missense probably damaging 1.00
R4828:Slc4a1ap UTSW 5 31530709 nonsense probably null
R5611:Slc4a1ap UTSW 5 31553829 utr 3 prime probably benign
R5991:Slc4a1ap UTSW 5 31534069 missense possibly damaging 0.92
R6531:Slc4a1ap UTSW 5 31548638 missense probably benign 0.18
R6602:Slc4a1ap UTSW 5 31527641 missense probably damaging 1.00
R6770:Slc4a1ap UTSW 5 31527882 intron probably null
R6844:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
R7103:Slc4a1ap UTSW 5 31543857 missense probably benign
R7342:Slc4a1ap UTSW 5 31536290 missense possibly damaging 0.89
R7378:Slc4a1ap UTSW 5 31527527 missense probably benign
R7527:Slc4a1ap UTSW 5 31534131 missense probably benign 0.04
R7603:Slc4a1ap UTSW 5 31546195 missense
R7608:Slc4a1ap UTSW 5 31536189 missense possibly damaging 0.51
R7781:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGATCACAAGTCCCCAAGG -3'
(R):5'- ACAGGATGCACCAATTCTACTC -3'

Sequencing Primer
(F):5'- GGTACCTTGAGCTACTTAGTGACAC -3'
(R):5'- CAGAGGACTTGAGTTCAGTACCC -3'
Posted On2016-11-08